Measurement of Transgenes Copy Number in Wheat Plants Using Droplet Digital PCR

Materials and Reagents

1. 2 mL safe-lock microcentrifuge tubes (Axygen, catalog number: MCT-200-C)

2. PCR plate heat seal, foil, pierceable (Bio-Rad, catalog number: 1814040)

3. ddPCR plates, 96-well, semi-skirted (Bio-Rad, catalog number: 12001925)

4. DG8^TM cartridge for QX200^TM/QX100^TM droplet generator (Bio-Rad, catalog number: 1864008)

5. Droplet generator DG8^TM gasket (Bio-Rad, catalog number: 1863009)

6. Restriction enzyme EcoRI (ThermoFisher, catalog number: FD0274)

7. RNase A (Sigma, CAS: 9001-99-4)

8. Nuclease-free water (ThermoFisher, catalog number: 10977015)

9. Qubit^TM dsDNA HS assay kit (ThermoFisher Scientific, catalog number: Q32851)

10. QX200^TM ddPCR^TM EvaGreen supermix (Bio-Rad, catalog number: 1864033)

11. QX200 droplet generation oil for EvaGreen^® (Bio-Rad, catalog number: 1864005)

12. 5' FAM^TM (6-Carboxyfluorescein) (ThermoFisher Scientific, catalog number: C1360)

13. 5' VIC^TM (6-VIC) (AAT Bioquest, catalog number: 212)

Equipment

1. Qubit^TM 4 fluorometer (ThermoFisher Scientific, catalog number: Q33238)

2. QX200^TM droplet generator (Bio-Rad, catalog number: 1864002)

3. Thermal cycler (e.g., Bio-Rad C1000 Touch thermal cycler, catalog number: 1851148)

4. Pipettes (10 µL, 20 µL, 100 µL)

5. Heat sealer (e.g., Eppendorf S100, catalog number: 5391000036)

6. DG8 cartridge holder (Bio-Rad, catalog number: 1863051)

7. QX200 droplet reader (Bio-Rad, catalog number: 1864003)

8. Droplet reader plate holder (Bio-Rad, catalog number: 12006834)

Software

1. Primer design software: Primer5

2. Sequence analysis software: DNAstar (https://www.dnastar.com/)

3. QuantaSoft^TM software (Bio-Rad, catalog number: 1863007) (https://www.bio-rad.com/)

4. Software capable of reading comma-separated values (.csv) files: Microsoft Excel

5. Droplet Digital^TM PCR Applications Guide: http://www.bio-rad.com/webroot/web/pdf/lsr/literature/Bulletin_6407.pdf

Procedure

1. Preparation of wheat materials

   1. Grow plants in a chamber/greenhouse with the corresponding conditions.

      Note: Here, wheat plants were grown in a growth chamber maintained at 16 °C ± 2 °C with a 16 h light and 8 h dark photoperiod and 70% relative humidity.

   2. Collect approximately 100 mg of leaf samples from two-weeks-old wheat plants in a 2 mL safe-lock microcentrifuge tube for genomic DNA extraction.

   3. Isolate total genomic DNA from wheat plant leaves using the CTAB method (Chen et al., 2014).

   4. Digest each sample of genomic DNA using the restriction enzyme EcoRI followed by RNase A treatment. An example restriction digestion reaction is shown in Table 1.

      
      

      Table 1. Example reaction for restriction endonuclease digestion of genomic DNA

      Components	Volume
      10× restriction enzyme buffer	5 μL
      EcoRI (10–20 U/μL)	2 μL
      Genomic DNA	1 μg
      Nuclease-free water	Up to 50 μL
      Total	50 μL

      
      

   5. Incubate the restriction reaction mixture at 37 °C for 1 h and then add 1 μL of RNase A. After incubation at 37 °C for 30 min, inactivate the mixture by heating at 95 °C for 10 min. Following inactivation, the digested genomic DNA can be used directly in the next step without further cleanup.

      
      

2. Primers selection

   1. The wheat puroindoline-b (PINb) gene with a single copy was used as a reference gene to estimate transgene copy number (Collier et al., 2017). The primers of target genes were designed using a primer design software (e.g., Primer 5), which amplifies a 100–120 base pair region of both transgene targets. An example of target genes primers and wheat PINb gene primers are shown in Table 2.

      
      

      Table 2. Primers used in ddPCR

      Name	Sequence	Length	Targets
      TaPINb-F	AGTTGGCGGCTGGTACAATG	20	Wheat PINb gene
      TaPINb-R	ACATCGCTCCATCACGTAATCC	23
      TaPINb-prove	FAM-TCAACAATGTCCGCAGGAGCG-VIC	23
      pUbi-F	GTAGATAATGCCAGCCTGTTAAAC	24	Ubi promoter
      pUbi-R	GACGCGACGCTGCTGGTT	18
      pUbi-prove	FAM-CGTCGACGAGTCTAACGGACACCAAC-VIC	29

      
      

   2. Each primer pair needs to be checked first in a test PCR reaction. Use the reaction with genomic DNA from non-transgenic wheat plants or H₂O as negative control. Assemble the reaction as shown in Table 3.

      
      

      Table 3. PCR reaction for testing ddPCR primer pairs

      Components	Stock concentration	Final concentration	Volume
      2×QX200TM ddPCRTM EvaGreen® supermix	2×	1×	5 μL
      Forward primer	2 μM	250 nM	1.25 μL
      Reverse primer	2 μM	250 nM	1.25 μL
      Genomic DNA			50 ng
      Nuclease-free water			Up to 10 μL
      Total			10 μL

      
      

   3. Label the reference gene probes with 5' FAM^TM (6-Carboxyfluorescein) and the transgene probes with 5' VIC^TM (6-VIC).

   4. The cycling conditions of the PCR reaction are shown in Table 4.

      
      

      Table 4. PCR cycling conditions for testing ddPCR primer pairs

      Step	Temperature (°C)	Time	Number of cycles
      Enzyme activation	95	5 min	1
      Denaturation	95	30 s	40
      Annealing	60	30 s
      Extension	72	30 s
      Signal stabilization	72	5 min	1
      Hold	10	∞	1

      
      

   5. Separate the PCR product by agarose gel electrophoresis. Obtain the single clear bands with the expected sizes for reference and target primers (Figure 1).

      
      

   
   Figure 1. Example of PCR product showing the expected sizes obtained for reference and target primers

   
   

3. ddPCR setup

   1. Assemble the PCR reactions as shown in Table 5. The genomic DNA from non-transgenic wheat plants or H₂O were used as template as negative controls and added into the reaction. The primers of reference gene and transgenic genes were mixed in one reaction for each sample. It is critical that the assayed ddPCR reactions are well mixed prior to proceeding to droplet generation. The concentration of each component must be the same in every droplet.

      
      

      Table 5. Example ddPCR reaction

      Components	Stock concentration	Final concentration	Volume
      2× QX200TM ddPCRTM EvaGreen® supermix	2×	1×	10 μL
      Forward primer of reference gene	2 μM	250 nM	2.5 μL
      Reverse primer of reference gene	2 μM	250 nM	2.5 μL
      Forward primer of reference gene	2 μM	250 nM	2.5 μL
      Reverse primer of reference gene	2 μM	250 nM	2.5 μL
      Genomic DNA			50 ng
      Nuclease-free water			Up to 20 μL
      Total			20 μL

      
      

4. Droplet generation

   1. Load the cartridge into the QX200 droplet generator.

   2. Load 20 μL of the ddPCR reaction into individual sample wells of the DG8^TM droplet generator cartridge.

   3. Add 70 μL of QX200 droplet generation oil for EvaGreen^® into the oil wells.

   4. Cover the cartridge with the DG8^TM gasket (Figure 2).

      
      

      
      Figure 2. Workflow of droplet generation

      
      

   5. The QX200 droplet generator uses microfluidics to combine oil and aqueous samples to generate the nanoliter-sized droplets required for ddPCR analysis. It processes up to eight samples at a time in approximately 2 min.

   6. Transfer the entire volume of the droplet emulsion (typically 70 μL) to the desired wells of a semi-skirted 96-well ddPCR plate.

   7. Cover the 96-well ddPCR plate with a pierceable foil plate heat seal using a heat sealer according to the manufacturer’s instructions.

      Note: Take care to pipette very slowly to avoid disrupting the emulsified droplets.

   8. Place the 96-well ddPCR plate containing the PCR products into a thermal cycler and use cycling conditions as shown in Table 6. The annealing temperature was decided by the Tm value of the primers (normally < 5 °C than Tm value).

      
      

      Table 6. PCR cycling conditions for ddPCR. Use a 2 °C/s ramping rate for all steps.

      Step	Temperature (°C)	Time	Number of cycles
      Enzyme activation	95	10 min	1
      Denaturation	94	30 s	40
      Annealing	58	1 min
      Signal stabilization	98	10 min	1
      Hold	10	∞	1

      
      

5. Droplet counting

   1. Switch on the QX200^TM droplet reader and open the QuantaSoft^TM software after the PCR cycle is finished.

   2. Turn on the new experiment in the QuantaSoft^TM software.

   3. Select the wells that need detection, enter the sample names, and record the well positions for target and reference genes for each sample.

   4. Select the key parameters in the wells that need detection as follows:

      1. Experiment: ABS (absolute quantitation).

      2. Supermix: QX200^TM ddPCR EvaGreen supermix.

      3. Target 1 type: Ch1 unknown.

      4. Target 2 type: Ch2 unknown.

      5. Enter the sample name to distinguish transgenes and reference genes.

   5. Apply the chosen parameters to the selected wells by clicking OK.

   6. Place the 96-well PCR plate into the plate holder as follows (Figure 3):

      1. Place the 96-well PCR plate containing the amplified droplets into the base of the plate holder. Well A1 of the PCR plate must be in the top-left position.

      2. Move the release tabs of the top of the plate holder to the “up” position and place the top on the PCR plate. Firmly press down both release tabs to secure the PCR plate in the holder.

         
         

      
      Figure 3. Placing the 96-well plate into the plate holder

      
      

   7. After closing the lid, check if the indicator lights for “power,” “bottle level,” and “plate in place” are green.

   8. Click Run in the left navigation bar to start the run.

   9. In the Run Options window, select the detection chemistry.

      Note: If a probe supermix is selected in the well editor, the probe dye setting appears; select FAM/HEX or FAM/VIC. If an EvaGreen supermix is selected, the EvaGreen dye setting appears, and the screen confirms the number of EvaGreen wells configured on the plate.

Data analysis

1. Click the Analysis button to analyze the data after reading is complete.

2. Click the 1D Amplitude button to analyze the data collected from each channel of selected wells. The radio button is used to select the channels and provides options for adjusting the thresholds used in assigning positives and negatives for each channel. An example distribution is shown in Figure 4.

   Note: A single reaction should produce 12,000–20,000 droplets. The calculation of copy number relies on the ratio of positive to negative droplets.

   
   

   
   Figure 4. Example plot showing positive droplets for six samples. Green and blue droplets indicate VIC and FAM probes. The x-axis (event number) indicates the number of droplets measured across the total experiment and the y-axis shows the amplitude of fluorescence. The image of these samples was published in a previous study (P. Liu et al., 2021).

   
   

3. Click the 2D Amplitude button to view the channel 1 vs. channel 2 scatter plot and enable options for manually or automatically adjusting the thresholds used in assigning positives and negatives for each channel (Figure 5).

   
   

   
   Figure 5. Droplets of six examples visualized in two dimensions. The image of this sample was published in a previous study (P. Liu et al., 2021).

   
   

4. Click the concentration button to visualize data in concentration plots. Export the concentration data as a comma-separated values (.csv) file.

   Note: The “copies/μL well” column displays the total amount of starting material in the ddPCR sample.

5. Click Copy Number to view copy number for selected well/samples (Figure 6).

   
   

   
   Figure 6. Display of the calculated transgene copy number values of six examples. The image of these samples was published in a previous study (P. Liu et al., 2021).

   
   

6. Click Ratio button to view ratio data for selected well/samples. Use the ratio buttons to select a plot of the Ratio (unknown: reference) or Fractional Abundance (% of sample).

7. Click Events to view the number of droplet events counted for selected well/samples.

Acknowledgments

We acknowledge financial support from China Agriculture Research System from the Ministry of Agriculture of the P.R. China (CARS-03), National Natural Science Foundation of China (32100126, 31901954), Ningbo Science and Technology Innovation 2025 Major Project, China (Q21C140013), Natural Science Foundation of Zhejiang Province, China (LQ20C140002), and K.C. Wong Magna Funding Ningbo University. This protocol was developed to generate the transgene copy number in a previous study (P. Liu et al., 2021).

Competing interests

No competing interests to declare.

References

1. Bharuthram, A., Paximadis, M., Picton, A. C. P. and Tiemessen, C. T. (2014). Comparison of a quantitative Real-Time PCR assay and droplet digital PCR for copy number analysis of the CCL4L genes. Infect Genet Evol 25: 28-35.
2. Bubner, B. and Baldwin, I. T. (2004). Use of real-time PCR for determining copy number and zygosity in transgenic plants. Plant Cell Rep 23(5): 263-271.
3. Collier, R., Dasgupta, K., Xing, Y. P., Hernandez, B. T., Shao, M., Rohozinski, D., Kovak, E., Lin, J., de Oliveira, M. L. P., Stover, E., et al. (2017). Accurate measurement of transgene copy number in crop plants using droplet digital PCR. Plant J 90(5): 1014-1025.
4. Chen, M., Sun, L., Wu H, Chen, J., Ma, Y., Zhang, X., Du, L., Cheng, S., Zhang, B., Ye, X., et al. (2014). Durable field resistance to wheat yellow mosaic virus in transgenic wheat containing the antisense virus polymerase gene. Plant Biotechnol J 12(4): 447-456.
5. Gowacka, K., Kromdijk, J., Leonelli, L., Niyogi, K. K. and Long, S. P. (2015). An evaluation of New and established methods to determine T-DNA copy number and homozygosity in transgenic plants. Plant Cell Environ 39(4): 908-917.
6. Hanhineva, K. J. and Krenlampi, S. O. (2007). Production of transgenic strawberries by temporary immersion bioreactor system and verification by TAIL-PCR. Bmc Biotechnol 7(1): 11.
7. Hindson, C. M., Chevillet, J. R., Briggs, H. A., Gallichotte, E. N. and Tewari, M. (2013). Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods 10(10): 1003-1005.
8. Higuchi, R., Fockler, C., Dolinger, G. and Watson, R. (2013). Kinetic PCR: Real time monitoring of DNA ampli cation reactions. Biotechnol 11(9): 1026-1030.
   
9. Hobbs, S., Warkentin, T. D. and Delong, C. (1993). Transgene copy number can be positively or negatively associated with transgene expression. Plant Mol Biol 21(1): 17-26.
10. Liu, P., Zhang, X., Zhang, F., Xu, M., Ye, Z., Wang, K., Liu, S., Han, X., Cheng, Y. and Zhong, K. (2021). A virus-derived siRNA activates plant immunity by interfering with ROS scavenging. Mol Plant 14(7): 1088-1103.
11. Liu, Y. G., Mitsukawa, N., Oosumi, T. and Whittier, R. F. (1995). Efficient isolation and mapping of Arabidopsis thealiana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J 8(3): 457-463.
12. Sivamani, E., Li, X., Nalapalli, S., Barron, Y. and Que, Q. (2015). Strategies to improve low copy transgenic events in Agrobacterium-mediated transformation of maize. Transgenic Res 24(6): 1-11.
13. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98(3): 503-517.
14. Srivastava, V., Vasil, V. and Vasil, I. K. (1996). Molecular characterization of the fate of transgenes in transformed wheat (Triticum aestivum L.). Theor Appl Genet 92(8): 1031-1037.
15. Wu, Y., Li, J., Li, X., Liang, J., Zeng, X. and Wu, G. (2017). Copy number and zygosity determination of transgenic rapeseed by droplet digital PCR. Oil Crop Science 2: 84-94.
16. Vasil, I. K. (2007). Molecular genetic improvement of cereals: transgenic wheat (Triticum aestivum L.). Plant Cell Rep 26(8): 1133-1154.