Published: Vol 12, Iss 5, Mar 5, 2022 DOI: 10.21769/BioProtoc.4345 Views: 7711
Reviewed by: Alessandro DidonnaRita Marie Celine MeganckAnonymous reviewer(s)

Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
Related protocols

In situ Quantification of Cytosine Modification Levels in Heterochromatic Domains of Cultured Mammalian Cells
María Arroyo [...] Florian D. Hastert
Jul 20, 2023 1888 Views

Efficient Large DNA Fragment Knock-in by Long dsDNA with 3′-Overhangs Mediated CRISPR Knock-in (LOCK) in Mammalian Cells
Wenjie Han [...] Jianqiang Bao
Oct 20, 2023 3046 Views

CRISPR/dCas9-Tet1-Mediated DNA Methylation Editing
Junming Qian and Shawn X. Liu
Apr 20, 2024 4666 Views
Abstract
In recent years, DNA methylation research has been accelerated by the advent of nanopore sequencers. However, read length has been limited by the constraints of base conversion using the bisulfite method, making analysis of chromatin content difficult. The read length of the previous method combining bisulfite conversion and long-read sequencing was ~1.5 kb, even using targeted PCR. In this study, we have improved read length (~5 kb), by converting unmethylated cytosines to uracils with APOBEC enzymes, to reduce DNA fragmentation. The converted DNA was then sequenced using a PromethION nanopore sequencer. We have also developed a new analysis pipeline that accounts for base conversions, which are not present in conventional nanopore sequencing, as well as errors produced by nanopore sequencing.
Keywords: DNA methylationBackground
DNA methylation is an important mechanism for epigenetic regulation of gene expression (Greenberg and Bourc’his, 2019). It has a wide range of effects on genes via several biological processes. DNA methylation is usually detected and analyzed using bisulfite sequencing short reads. However, it is difficult to align these short reads (~150 bp) to some chromosomal regions, such as repetitive sequences and structural variants (Goerner-Potvin and Bourque, 2018). Similarly, short reads also constrain detection of chromosome-specific methylation patterns, such as imprinted regions, in polyploid organisms (Akbari et al., 2021). A comprehensive understanding of epigenetic regulation by DNA methylation will therefore require complementary methods.
The bisulfite method distinguishes between unmethylated and methylated cytosine (C vs. mC), by chemically converting unmethylated C to uracil (U) and to thymine (T), by subsequent amplification (Lister et al., 2009). However, since this reaction is carried out under chemically severe conditions, a large proportion of the DNA in the reaction is fragmented and degraded. The genomic regions that undergo this degradation show biased representation (Olova et al., 2018), further limiting the experimental conclusions this method can provide. The read length of the previous method combining bisulfite conversion and long-read sequencing was only ~1.5 kb, even using targeted PCR (Yan et al., 2015). Recently, enzymatic methyl sequencing (EMseq) was developed as an alternative to the bisulfite method of base conversion (Vaisvila et al., 2021). EMseq involves the oxidation of mC by ten-eleven translocation (TET) enzymes to protect them, followed by base conversion of unmethylated C to U, by APOBEC enzymes. Via the amplification process, U is converted to T, as in the bisulfite method. Because this reaction is performed under milder chemical conditions than with the bisulfite method, longer DNA fragments are obtainable. In fact, a previous study showed that DNA fragments over 5 kb long can be obtained using EMseq and target-specific PCR, and that these fragments can be successfully sequenced in a long-read sequencer (Sun et al., 2021).
Nanopore sequencers read nucleic acid sequences by measuring the change in electric current while the nucleic acids are passing through the nanopore. The maximum read length of nanopore sequencing is over 100 kb (Sakamoto et al., 2020). By recognizing specific electrical patterns for modified bases, base modifications can also be detected (Rand et al., 2017; Simpson et al., 2017). However, while the base-reading accuracy of nanopore sequencers is currently up to 90%, this is not quite high enough to accurately infer methylation patterns (Sakamoto et al., 2020). Furthermore, it requires about 500 ng–1 µg of DNA input, reducing its practical utility for rare samples, such as clinical specimens and biopsies. Although several methods combining base-conversion and long-read sequencing have been developed, thus far all have employed gene-specific amplification (Yang et al., 2015; Liu et al., 2020; Sun et al., 2021). A method for whole-genome methylation analysis by this method, and a bioinformatic pipeline to process the sequence data it generates, have not heretofore been developed.
Here, we report a method for whole-genome long-read methylation sequencing, using a relatively small amount of input DNA, for nanopore sequencing of base-converted DNA by APOBEC enzymes (Figure 1) (Sakamoto et al., 2021). Our method, which we designate nanoEM, allows for whole-genome long-read methylation analysis with 10–100 ng of DNA. In addition, we have developed a data analysis pipeline for nanoEM reads by adopting a three-letter alignment approach to long-read alignment. NanoEM is an useful approach for detecting methylation status of structural variants (SVs), repetitive regions, and imprinting regions, which are difficult to analyze using short read sequencing (Sakamoto et al., 2021).

Figure 1. Flow chart of the experimental procedure.
Materials and Reagents
Filter pipette tips 10, 20, 200, and 1,000 µL [e.g., Pipette Tips RT UNV F (RAININ, catalog numbers: 30389172, 30389189, 30389186, and 30389165)]
1.5 mL tubes [e.g., DNA LoBind Tube 1.5 mL (Eppendorf, catalog number: 0030108051)]
PCR tubes [e.g., Temp Assure 0.2 mL PCR 8-Tube Strips, Att. Optical Caps (USA Scientific, catalog number: 1402-4700)]
Mag Attract HMW DNA Kit (QIAGEN, catalog number: 67563)
g-TUBE (Covaris, catalog number: 520079)
Ethanol (e.g., FUJIFILM WAKO Pure Chemical Corporation, catalog number: 057-00456)
Nuclease-free water (Thermo Fisher Scientific, catalog number: AM9930)
Formamide (FUJIFILM Wako Pure Chemical Corporation, catalog number: 064-00423)
NEBNext Enzymatic Methyl-seq kit (New England Biolabs, catalog number: E7120S)
KOD One PCR Master Mix (TOYOBO, catalog number: KMM-101)
Ligation Sequencing kit (Oxford Nanopore Technologies, catalog number: SQK-LSK110)
PromethION flowcell (Oxford Nanopore Technologies, catalog number: FLO-PRO002)
NEBNext Ultra II End Repair/dA-Tailing Module (New England Biolabs, catalog number: E7546)
NEBNext FFPE DNA Repair Mix (New England Biolabs, catalog number: M6630)
NEBNext Quick Ligation Module (New England Biolabs, catalog number: E6056)
Qubit ds DNA HS Assay kit (Thermo Fisher Scientific, catalog number: Q32854)
Agilent DNA 12000 kit (Agilent Technologies, catalog number: 5067-1508)
Agencourt AMPure XP (Beckman Coulter, catalog number: BC-A63880)
DNA Clean & Concentrator-5 (Zymo Research, catalog number: D4013)
ProNex Size-Selective DNA Purification System (Promega, catalog number: NG2001)
TET2 Reaction Buffer with supplement (see Recipes)
70% and 80% (v/v) ethanol (see Recipes)
Wash Buffer of ProNex Size-Selective DNA Purification System (NG2001) (see Recipes)
Equipment
PromethION sequencing device (Oxford Nanopore Technologies, catalog number: PRM48BasicSP)
2100 Bioanalyzer Instrument (Agilent Technologies, catalog number: G2939BA)
Thermal cycler [e.g., T100 thermal cycler (Bio-Rad, catalog number: 1861096)]
Qubit 4 Fluorometer (Thermo Fisher Scientific, catalog number: Q33238)
Vortex Mixer [e.g., Vortex-Genie 2 (Scientific Industries, catalog number: SI-0236)]
High speed centrifuge (e.g., MDX-310 with rack for 2 mL × 24 tubes, TOMY SEIKO)
Tabletop centrifuge for 1.5 and 0.2 mL tubes [e.g., MyFuge mini centrifuge (Benchmark Scientific, catalog number: C1008-B)]
Magnetic stand for 1.5 and 2 mL tubes [e.g., DynaMag-2 (Thermo Fisher Scientific, catalog number: 12321D)]
Magnetic stand for 0.2 mL tubes [e.g., 10× Magnetic Separator (10× Genomics, catalog number: 120250)]
Pipettes for 10, 20, 200, and 1,000 μL tips
Racks for 0.2 mL PCR tubes and 1.5 mL tubes
Software
Python3 (version 3.8.6, https://www.python.org/downloads/)
pysam (version 0.17.0, https://github.com/pysam-developers/pysam)
minimap2 (version 2.22) (Li, 2018)
sambamba (version 0.7.1) (Tarasov et al., 2015)
samtools (version 1.9) (Li et al., 2009)
Integrated Genome Viewer (IGV) (version 2.5.3) (Thorvaldsdóttir et al., 2013)
Procedure
DNA Extraction
The MagAttract HMW DNA Kit is used for DNA extraction from cultured cells (<2 × 109 cells) and/or clinical specimens (<25 mg tissues), in accordance with the manufacturer's instructions without modification (Note 1).
DNA Fragmentation
For fragmentation of genomic DNA, add 150 µL of DNA (<4 µg) diluted with nuclease-free water (NFW) to a g-TUBE, and centrifuge twice at 4,700 × g and room temperature (RT) for 1 min. Using the Bioanalyzer with the Agilent DNA 12000 kit, measure the concentration and the length distribution of the fragmented DNA following the manufacturer’s protocol (Note 2). Apply 10–50 ng of fragmented DNA to the next step, diluted with NFW to a 50 µL volume.
End Repair and Adaptor Ligation
Set up the programs of Steps 3, 5, and 12 in a thermal cycler.
Combine 50 µL of the fragmented DNA, 7 µL of NEBNext Ultra II End-Prep Reaction Buffer, and 3 µL of NEBNext Ultra II End-Prep Enzyme Mix in a PCR tube. Mix by pipetting.
Incubate at 20°C for 30 min, at 65°C for 30 min, then hold at 4°C in a thermal cycler with the heated lid set to 75°C.
Add 2.5 µL of NEBNext EMseq Adaptor, 1 µL of NEBNext Ligation Enhancer, and 30 µL of NEBNext Ultra II Ligation Master Mix to the sample. Mix by pipetting.
Incubate at 20°C for 15 min, then hold at 4°C in a thermal cycler with the heated lid off.
Add 110 µL of NEBNext Sample Purification Beads to the sample. Mix by pipetting. Incubate at RT for 5 min.
Place the tube on a magnetic stand for 0.2 mL tubes until it becomes clear (it takes ~2 min) (Figure 2). Remove and discard the supernatant.
Add 200 µL of 80% ethanol to the tube. After 30 s, remove and discard the supernatant.
Repeat Step 8 once.
Remove the tube from the magnetic stand and spin down on a tabletop centrifuge (~2,000 × g at RT). Place the tube on the magnetic stand. Remove and discard the remaining supernatant completely.
Air dry the pellet for 1 min.
Remove the tube from the magnetic stand. Elute the DNA from the beads by adding 29 µL of Elution Buffer from the EMseq kit and incubating at 37°C in a thermal cycler for 10 min.
Place the tube on the magnetic stand until it becomes clear (it takes ~2 min) (Figure 2). Transfer 28 µL of the supernatant to a new PCR tube.

Figure 2. Bead separation by magnetic stand. (A) Suspended beads before magnetic separation. (B) Insufficient separation of beads. The solutions are slightly cloudy. (C) Sufficient separation of beads. The solutions are clear.
Oxidation of 5 mC’s/5 hmC’s
Set up the programs of Steps 5, 7, and 14 in a thermal cycler.
Add 10 µL of TET2 Reaction Buffer with supplement, 1 µL of Oxidation Supplement, 1 µL of DTT, 1 µL of Oxidation Enhancer, and 4 µL of TET2 from the EMseq kit. Mix by pipetting.
Dilute 1 µL of 500 mM Fe(II) Solution from the EMseq kit in 1,249 μL of NFW in a new 1.5 mL tube.
Add 5 µL of the diluted Fe (II) Solution to the sample. Mix by pipetting.
Incubate at 37°C in a thermal cycler with the heated lid set to 45°C for 1 h.
Add 1 µL of Stop Reagent to the sample. Mix by pipetting.
Incubate at 37°C in the thermal cycler with the heated lid set to 45°C for 30 min.
Add 90 µL of NEBNext Sample Purification Beads from the EMseq kit to the sample. Mix by pipetting. Incubate at RT for 5 min.
Place the tube on a magnetic stand for 0.2 mL tube until it becomes clear (it takes ~2 min) (Figure 2). Remove and discard the supernatant.
Add 200 µL of 80% ethanol to the tube. After 30 s, remove and discard the supernatant.
Repeat Step 10 once.
Remove the tube from the magnetic stand and spin down on a tabletop centrifuge. Place the tube on the magnetic stand. Remove and discard the remaining supernatant completely.
Air dry the pellet for 1 min.
Remove the tube from the magnetic stand until it becomes clear (it takes ~2 min) (Figure 2). Elute the target DNA from the beads by adding 17 µL of Elution Buffer from the EMseq kit and incubating at 37°C in the thermal cycler for 10 min.
Place the tube on the magnetic stand until it becomes clear (it takes ~2 min) (Figure 2). Transfer 16 µL of the supernatant to a new PCR tube.
Denaturation of Cytosines
Set up the program of Step 3 in a thermal cycler.
Add 4 µL of formamide to the sample. Mix by pipetting.
Incubate at 85°C in a thermal cycler with the heated lid set to 95°C for 10 min, then place on ice immediately.
Deamination of Cytosines
Set up the programs of Steps 3 and 10 in a thermal cycler.
Add 68 µL of NFW, 10 µL of APOBEC Reaction Buffer, 1 µL of BSA, and 1 µL of APOBEC from the EMseq kit to the sample. Mix by pipetting.
Incubate at 37°C for 3 h, then hold at 4°C, in a thermal cycler with the heated lid set to 45°C.
Add 100 µL of NEBNext Sample Purification Beads from the EMseq kit to the sample. Mix by pipetting. Incubate for 5 min at RT.
Place the tube on the magnetic stand for 0.2 mL tubes until it becomes clear (it takes ~2 min) (Figure 2). Remove and discard the supernatant.
Add 200 µL of 80% ethanol to the tube. After 30 s, remove and discard the supernatant.
Repeat Step 6 once.
Remove the tube from the magnetic stand and spin down on a tabletop centrifuge. Place the tube on the magnetic stand. Remove and discard the remaining supernatant completely.
Air dry the pellet for 1 min.
Remove the tube from the magnetic stand. Elute the target DNA from the beads by adding 41 µL of NFW and incubating at 37°C in a thermal cycler with the heated lid set to 45°C for 10 min (Note 3).
Place the tube on the magnetic stand until it becomes clear (it takes ~2 min) (Figure 2). Transfer 20 µL of the supernatant to two PCR tubes (each tube contains of the supernatant).
PCR Amplification
Set up the PCR program of Step 3 in a thermal cycler.
Add 5 µL of the custom primer mix (10 µM each, described in Table 1), and 25 µL of KOD ONE PCR Master Mix to each tube. Mix by pipetting.
Perform PCR amplification of both tubes using the following PCR program: 13–16 cycles of 94°C for 15 s, at 57°C for 5 s, 68°C for 15 min, then hold at 4°C. The number of PCR cycles depend on the amount of input DNA (16 cycles for 10 ng DNA input, 13 cycles for 50 ng DNA input) and the quality of DNA.
Table 1. PCR program
| Temperature | Time | Cycles |
| 94°C | 15 s | 13–16 |
| 57°C | 5 s | |
| 68°C | 15 min | |
| 4°C | Hold | 1 |
Combine the separately amplified samples into one tube. Purify the sample by using a purification column of DNA Clean & Concentrator-5, according to the manufacturer’s instructions. Elute the DNA from the column by adding 52 µL of NFW, pre-incubated at 70°C. Repeat the elution step by adding the 52 µL of flowthrough back to the column. The quality of the purified DNA is measured using the Agilent DNA 12000 kit (Figure 3A).
Table 2. Custom primer sequences
| Primer | |
| Forward primer | CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT |
| Reverse primer | AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
Size Selection
Set up the programs of Step 8 in a thermal cycler.
Add 41–45 µL of ProNEX Chemistry (0.82–0.9×) to 50 µL of the DNA. Incubate at RT for 10 min.
Place the tube on a magnetic stand for 0.2 mL tubes until it becomes clear (it takes ~2 min) (Figure 2). Remove and discard the supernatant.
Add 200 µL of wash buffer to the tube. After 30 s, remove and discard the supernatant.
Repeat Step 4 once.
Remove the tube from the magnetic stand and spin down on a tabletop centrifuge. Place the tube on the magnetic stand. Remove and discard the remaining supernatant completely.
Air dry the pellet for 1 min.
Remove the tube from the magnetic stand. Elute the target DNA from the beads by adding 51 µL of NFW and incubating at 37°C in the thermal cycler with the heated lid set to 45°C for 10 min.
Place the tube on a magnetic stand until it becomes clear (it takes ~2 min) (Figure 2). Transfer 50 µL of the supernatant to a new PCR tube. The quality and quantity of the purified DNA are assessed using the Agilent DNA 12000 kit (Note 2) and the Qubit ds DNA HS Assay kit (Figure 3B) (Note 4).

Figure 3. Amplicon of base-converted DNA. (A and B) The amplicon distribution of base-converted DNA (A) before and (B) after size selection. DNA was quantified with the Agilent DNA 12000 kit. The reaction was performed with 50 ng of fragmented DNA from a breast cancer cell line BT-474 (Lasfargues et al., 1978). The amplification was performed with 13 cycles of polymerase chain reaction, using the KOD ONE PCR Master Mix and the primers described in Table 1. Size selection of the amplified DNA was performed using the 0.82× volume of ProNEX Chemistry.
Library Preparation for Nanopore Sequencing
Set up the programs of Steps 3 and 22 in a thermal cycler.
Combine 48 µL of the sample, 3.5 µL of NEBNext FFPE DNA Repair Buffer, 3.5 µL of Ultra II End-Prep Reaction Buffer, 2 µL of NEBNext FFPE DNA Repair Mix, and 3 µL of Ultra II End-Prep Enzyme Mix in a new PCR tube. Mix by flicking the tube and spin down on a tabletop centrifuge.
Incubate at 20°C for 5 min, then 65°C for 5 min, in a thermal cycler with the heated lid set to 75°C.
Add 60 µL of AMPure XP beads to the sample. Mix by flicking the tube and spin down on a tabletop centrifuge.
Incubate at RT for 5 min.
Place the tube on a magnetic stand for 0.2 mL tubes until it becomes clear (it takes ~2 min) (Figure 2). Remove and discard the supernatant.
Add 200 µL of 70% ethanol to the tube. After 30 s, remove and discard the supernatant.
Repeat Step 7 once.
Remove the tube from the magnetic stand and spin down on a tabletop centrifuge. Place the tube on the magnetic stand. Remove and discard the remaining supernatant completely.
Air dry the pellet for 1 min.
Remove the tube from the magnetic stand. Elute the DNA from the beads by adding 61 µL of NFW and incubating at 37°C in a thermal cycler with the heated lid set to 45°C for 10 min.
Place the tube on the magnetic stand until it becomes clear (it takes ~2 min) (Figure 2). Transfer 61 µL of the supernatant to a new PCR tube. Use 1 µL of the sample for quantification by Qubit ds DNA HS Assay kit.
Add 25 µL of ligation buffer, 10 µL of NEBNext Quick T4 DNA Ligase, and 5 µL of Adapter Mix F to the sample. Mix by flicking the tube and spin down on a tabletop centrifuge.
Incubate at RT for 10 min.
Add 40 µL of AMPure XP beads to the sample. Mix by flicking the tube and spin down on a tabletop centrifuge.
Incubate at RT for 5 min.
Place the tube on a magnetic stand for 0.2 mL tubes until it becomes clear (it takes ~2 min) (Figure 2). Remove and discard the supernatant.
Remove the tube from the magnetic stand. Wash the beads by adding 250 µL of long fragment buffer to the tube. After flicking the beads to resuspend, return the sample to the magnetic stand. Once the solution is clear, remove and discard the supernatant.
Repeat Step 18 once.
Remove the tube from the magnetic stand and spin down on a tabletop centrifuge. Place the tube on the magnetic stand. Remove and discard the remaining supernatant completely.
Air dry the pellet for 30 s.
Remove the tube from the magnetic stand. Elute the DNA from the beads by adding 25 µL of elution buffer from the Ligation Sequencing kit and incubating at 37°C in a thermal cycler with the heated lid set to 45°C for 10 min.
Place the tube on a magnetic stand until it becomes clear (it takes ~2 min) (Figure 2). Transfer 25 µL of the supernatant to a new PCR tube. Use 1 µL of the sample for quantification by Qubit ds DNA HS Assay kit. Estimate the molarity of the prepared library by correcting the mass concentration of the library with the mole and mass concentrations of the DNA before library preparation. Apply 5–50 fmol of the eluted library to the next step (Note 5). If more than 50 fmol of DNA is contained in 24 µL of the library, diluted 5–50 fmol of the library up to 24 µL by elution buffer from the Ligation Sequencing kit.
Priming and Loading the PromethION Flowcell
Add 30 µL of Flush Tether (FLT) to one tube of Flush Buffer (FB). Mix by vortexing.
Set the flowcell to the PromethION sequencer. Remove air from the inlet port of the flowcell by pipetting, to avoid the introduction of air bubbles.
Prime the flowcell with 500 µL of FB/FLT mix. After incubation for 5 min, re-prime with 500 µL of FB/FLT mix.
Add 75 µL of Sequencing Buffer II and 51 µL of re-suspended Loading Beads II to the library.
Mix by gently pipetting. Immediately load the 150 µL of library to the flowcell and run the program. A video for priming and loading the flow cell of PromethION is available on the community site of Oxford Nanopore Technologies (https://community.nanoporetech.com/protocols/genomic-dna-by-ligation-sqk-lsk110/v/gde_9108_v110_revl_10nov2020/priming-and-loading-the-flow-cell?devices=promethion).
Data analysis
Two fastq files containing 1d pass reads or 1d fail reads are generated via the real-time basecalling of Guppy, a basecaller integrated into MinKNOW software for the PromethION sequencer. A fastq file contains the base sequence and the quality of each of the bases for sequence reads. We recommend using the fastq file of 1d pass reads, which passed the filter of base quality, for the data analysis. DNA sequence after base-conversion by bisulfite or EMseq consists of A, G, T (original T and unmethylated C), and C (methylated C) in the original strand, or A (complementary of original T and unmethylated C), G (complementary of methylated C), T, and C in the complementary strand generated by PCR. Therefore, it is difficult to align the sequence to the normal reference sequence. To map nanoEM data to reference genome data, we adopted a three-letter alignment approach—which is also used for Bismark (Krueger and Andrews, 2011)—to long-read alignment. In the three-letter approach, to enable alignment of the base-converted reads, two types of reads are computationally prepared, where all the C are converted to T or all the G are converted to A, and two types of the reference genome sequence, where all the C are converted to T or all the G are converted to A. After alignment of the reads to the reference genomes, it is possible to determine whether each read is derived from the original or complementary strand, by choosing the best alignment combination with the best alignment score for each read, and to detect the methylation status of each C, by referring to the original sequence of reads and reference genome. A flow chart of the data analysis is shown in Figure 4. To perform the operations correctly, all information, including bioinformatics scripts and explanation, is available in a GitHub repository at this link: https://github.com/yos-sk/nanoEM. Software used in this protocol can be easily installed via the conda command of miniconda (https://docs.conda.io/en/latest/miniconda.html) or anaconda (https://www.anaconda.com/products/individual).

Convert bases of reference genome
From a fasta file (ref.fa) of the reference genome (such as human genome hg38), generate a fasta file (output.fa) for a modified reference genome, representing the reference genome with the Cs converted to Ts, and with the Gs converted to As on the reverse strand.
$ python src/convert_ref.py ref.fa > output.fa
Convert bases of nanoEM data
From the compressed fastq file of nanoEM reads (1d_pass.fq.gz), generate two modified fastq files: one with the Cs converted to Ts (1d_pass_CT.fq.gz), the other with Gs converted to As (1d_pass_GA.fq.gz).
$ python src/convert_reads.py 1d_pass.fq.gz
Map the converted nanoEM reads (1d_pass_CT.fq.gz and 1d_pass_GA.fq.gz) to the converted reference genome (output.fa). Map the processed nanoEM reads to the processed reference genome, using minimap2 with the “map-ont” option. Then, two bam files (1.sorted.bam and 2.sorted.bam) and two respective index files (1.sorted.bam.bai and 2.sorted.bam.bai) are generated.
$ minimap2 -t 8 –split-prefix temp_sam1 -ax map-ont output.fa 1d_pass_CT.fq.gz –eqx | samtools view -b | samtools sort -@ 8 -o 1.sorted.bam
$ samtools index 1.sorted.bam
$ minimap2 -t 8 –split-prefix temp_sam2 -ax map-ont output.fa 1d_pass_GA.fq.gz –eqx | samtools view -b | samtools sort -@ 8 -o 2.sorted.bam
$ samtools index 2.sorted.bam
Choose the best alignments
From the alignment results (1.sorted.bam and 2.sorted.bam), select the most appropriate alignment combination by the alignment score. Then, two bam files (output_CT.sorted.bam and output_GA.sorted.bam) and two corresponding index files (output_CT.sorted.bam.bai and output_GA.sorted.bam.bai) are generated.
$ python src/best_align.py --bam1 1.sorted.bam --bam2 2.sorted.bam --fastq nanoEM_read.fq.gz
$ samtools view -b output_CT.sam | samtools sort -o output_CT.sorted.bam
$ samtools view -b output_GA.sam | samtools sort -o output_GA.sorted.bam
$ rm output_*.sam
$ samtools index output_CT.sorted.bam
$ samtools index output_GA.sorted.bam
Call methylation
Using the sambamba mpileup command, detect the methylation frequencies of the cytosines in the CpG sites of the reference genome (ref.fa). After processing by a python script (src/call_methylation.py), a tsv file of methylation frequency (frequency_methylation.tsv) is generated.
$ sambamba mpileup output_CT.sorted.bam -L cpg_sites.bed -o pileup_CT.tsv -t 8 --samtools -f ref.fa
$ sambamba mpileup output_GA.sorted.bam -L cpg_sites.bed -o pileup_GA.tsv -t 8 --samtools -f ref.fa
$ python src/call_methylation.py pileup_CT.tsv pileup_GA.tsv > frequency_methylation.tsv
Visualize in bisulfite mode of IGV
To visualize in bisulfite mode of IGV, correct the sequence of G-to-A-converted reads (output_GA.sorted.bam) to that of the complementary strand and merge it (output_GA_vis.sorted.bam) with the bam file of the C-to-T-converted reads (output_CT.sorted.bam). After sorting, the merged bam file (output_merge.sorted.bam) can be visualized in the bisulfite mode of IGV. The bisulfite mode option can be activated from the right-click pop-up menu. Select “Color alignments by”, ”bisulfite mode”, then “CG”. Visualization of a typical nanoEM result is shown in Figure 5.
$ python script/vis_GA_utilities.py -b output_GA.sorted.bam | samtools view -b | samtools sort -@ 4 -o output_GA_vis.sorted.bam
$ samtools index output_GA_vis.sorted.bam
$ samtools merge output_merge.bam output_CT.sorted.bam output_GA_vis.sorted.bam
$ samtools sort -@ 4 -o output_merge.sorted.bam output_merge.bam
$ samtools index output_merge.sorted.bam

Figure 5. Visualization of nanoEM reads. Visualization of a representative nanoEM result in bisulfite mode of IGV, in the region surrounding the promoter of the gene PGR. Methylated and unmethylated CpGs are shown in red and blue, respectively. The annotations of CpG islands were obtained from the UCSC table browser (Karolchik et al., 2004).
Notes
We have successfully used this protocol with mammalian cell lines and human clinical specimens of lung and breast.
After filling the DNA chip with the pre-filtrated Gel-Dye mix by the Chip Priming Station, an accessory of the 2100 Bioanalyzer Instrument, add 9 µL of the Gel-Dye mix and 5 µL of the Marker to wells of the chip following the manufacturer’s instructions. Add 1 µL of the Ladder and 1 µL of the samples to the ladder well and the sample wells, respectively. After vortexing for 1 min, set the chip to 2100 Bioanalyzer Instrument and start measurement.
In this step, DO NOT use Elution Buffer from the EMseq kit, as it is detrimental to the subsequent PCR reaction.
We recommend using at least 200 ng of DNA for the subsequent library preparation of nanopore sequencing.
When the amount of library loaded is too high or too low, the yield of the sequencing data will be reduced.
Recipes
TET2 Reaction Buffer with supplement
Add 100 μL of TET2 Reaction Buffer to a tube of TET2 Reaction Buffer Supplement and mix by vortexing. The TET2 Reaction Buffer with supplement can be stored at -20°C for 4 months.
70% and 80% (v/v) ethanol
Mix ethanol and NFW. These reagents were freshly prepared at the time of use.
Wash Buffer of ProNex Size-Selective DNA Purification System (NG2001)
Add 75 mL of ethanol to a Bottle of Wash Buffer.
Acknowledgments
This protocol is based on our previous publication (Sakamoto et al., 2021). We are supported by JSPS KAKENHI [JP21K15074, JP19K16108]; MEXT KAKENHI [JP16H06279 (PAGS), JP17H06306, JP20H05906]; JSPS Fujita Memorial Fund for Medical Research; National Cancer Center Research and Development Fund (29-A-6).
Competing interests
There are no conflicts of interest or competing interests.
References
Article Information
Copyright
© 2022 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Zaha, S., Sakamoto, Y., Nagasawa, S., Sugano, S., Suzuki, A., Suzuki, Y. and Seki, M. (2022). Whole-genome Methylation Analysis of APOBEC Enzyme-converted DNA (~5 kb) by Nanopore Sequencing. Bio-protocol 12(5): e4345. DOI: 10.21769/BioProtoc.4345.
Category
Cancer Biology > Genome instability & mutation
Systems Biology > Epigenomics > DNA methylation
Molecular Biology > DNA > DNA modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link
