A High-throughput qPCR-based Method to Genotype the SOD1^G93A Mouse Model for Relative Copy Number

Materials and Reagents

Note: All storage is at room temperature unless otherwise specified.

1. QIAcube HT Plasticware (QIAGEN, catalog number: 950067)
2. Adhesive PCR Plate Seals (Thermo Fisher, Thermo Scientific, catalog number: AB0558)
3. Sterile Alcohol Prep Pads (Fisher Scientific, Fisherbrand, catalog number: 22-363-750)
4. 15 ml Centrifuge Tube (Corning, catalog number: 430766)
5. 96-well UV-Transparent Microplates (Corning, catalog number: 3635)
6. 384-well qPCR plate (Thermo Fisher, Applied BioSystems, catalog number: 4309849) 
7. Custom SOD1 MGB probe and primers (Thermo Fisher, Custom Genomics, -20 °C)
   1. Probe: SOD1HumanV2-55T (VIC-ACTCTCTCCAACTTTG) with VIC fluorescent reporter chemistry, 6000 pmole (wet, desalt) 
   2. Forward primer: SOD1HumanV2-27F (GTAAATCAGCTGTTTTCTTTGTTCAGA), 80,000 pmole (dry, desalt)
   3. Reverse primer: SOD1HumanV2-104R (TTCACTGGTCCATTACTTTCCTTTAA), 80,000 pmole (dry, desalt)
8. QIAamp 96 QIAcube HT Kit (QIAGEN, catalog number: 51331)
9. PBS, Phosphate Buffered Saline, 10x Solution (Fisher BioReagents, Fisher Scientific, catalog number: BP3994)
10. Alcohol, Reagent (Denatured Alcohol), 70% (v/v) Aqueous Solution (Ricca Chemical Company, Fisher Scientific, catalog number: 25467032, room temperature flammables cabinet)
11. Neosporin First Aid Antibiotic Ointment (Hanna’s Pharm Supply Co, catalog number: 302-571-8761)
12. Cotton-Tipped Applicators (Fisher Scientific, Puritan, catalog number: 22-029-571)
13. 50 ml Reagent Reservoir (Corning, Costar, catalog number: 4870)
14. DL-Dithiothreitol solution BioUltra for molecular biology, 1 M in H₂O (Millipore Sigma, Sigma-Aldrich, catalog number: 43816), 4 °C
15. Ethanol, Absolute (200 Proof), Molecular Biology Grade (Fisher Scientific, catalog number: BP2818100), room temperature flammables cabinet
16. Nuclease-Free Water (Thermo Fisher, Invitrogen, catalog number: AM9932)
17. TaqMan Genotyping Master Mix (Thermo Fisher, Applied Biosystems, catalog number: 4371355), 4 °C
18. TaqMan Gapdh Copy Number Assay (Thermo Fisher Assay ID Mm00186822cn), -20 °C
19. Sample Prep solution (see Recipes)
20. Tissue Digestion solution (see Recipes)
21. Primer Dilution solution (see Recipes)
22. SOD1^G93A Copy Number Genotyping qPCR Master Mix (see Recipes)
23. Primer/Probe solution (see Recipes)
    

Equipment

1. Two sterilized vessels for tissue harvest ethanol washes
2. Surgery-quality tools to harvest ear tissue (forceps and scissors, or ear punch)
3. Shaker capable of 18 h of 200 rpm and 56 °C incubation (Eppendorf, New Brunswick, catalog number: M1352-0010) (see Note 3)
4. Qiagen QIAcube HT (QIAGEN, catalog number: 9001793) (see Note 3)
5. SpectraMax M5 Multi-Mode Microplate Reader (Molecular Devices, catalog number: M5) (see Note 3)
6. NanoDrop^TM 8000 Spectrophotometer (Thermo Fisher, Thermo Scientific, catalog number: ND-8000-GL) (see Note 3)
7. Allegra X-22R Benchtop Centrifuge (Beckman Coulter, catalog number 392188) (see Note 3)
8. QuantStudio^TM 7 Flex Real-Time PCR System, 384-well, desktop (Thermo Fisher, catalog number: 4485701) (see Note 3)
   

Software

1. Excel 2013 (Microsoft)
2. Prism 6 (GraphPad, www.graphpad.com)
   

Procedure

1. Tissue collection
   Note: Although this protocol specifies extracting and analyzing genomic DNA from ear samples, 20 mg mouse tail tip samples may also be used.
   1. Preparation
      1. Create a plate map with samples organized top to bottom in columns (i.e., Sample 1 is in spot A1, Sample 2 is in spot B1, etc.). Remember that in every experiment, 8 sample spots need to be reserved for a standard curve, so the most mice that can be analyzed in a single qPCR is 88 (Figure 4A).
      2. Create Sample Prep solution (Recipe 1) with appropriate excess (at least 10). 
      3. Using an S-Block from the Qiagen QIAcube Plasticware kit, load 160 μl of the Sample Prep solution into every well of every column needed for the experiment (Figure 4B).
         Note: The QIAcube HT works in column format, and every well of the columns that are used (regardless of whether they contain a sample) needs to be filled in order for the automated protocol to work properly.
      4. Seal the top of the S-block with an adhesive plate seal.
         
         
         Figure 4. Sample collection plate example. A. Sample collection plate map for an 88-sample experiment, with placeholder wells for the standard curve. B. Qiagen S-Block.
         
         
   2. Sample Collection
      1. Fill two clean vessels with enough 70% reagent alcohol to wash tools.
      2. Pre-clean tools with 70% reagent alcohol.
      3. Collect an ear sample from each mouse that is 20 mg or less using scissors or ear punch (Figure 5); using forceps, place sample into the appropriate well according to the plate map.
      4. Apply antibiotic ointment to mouse ear using cotton-tipped applicator.
         Note: The antibiotic swab does not usually need to be cleaned between uses, but if the mouse bleeds, we replace the soiled swab.
      5. Swish forceps and scissors in first alcohol wash, wipe with alcohol prep pad to remove any solid material such as hairs, and then swish in second alcohol wash. Leave tools in the second wash until ready to use again; do not mix up washes because the first wash should function as a “dirty wash” and the second should function as a “clean wash”.
      6. Repeat with remaining mice, changing the alcohol prep pad and cleaning gloves often.
      7. Cover S-block with adhesive when you’re done and during any extended breaks.
         
         
         Figure 5. An ear tissue sample that is approximately 20 mg
         
         
   3. Sample digestion
      1. In reagent reservoir, create Tissue Digestion solution (Recipe 2) with appropriate excess (at least 10), mix well, and aseptically load 40 μl into sample wells in S-block; load recipe into any “blank” wells too (wells in a used column that do not have a sample).
      2. Ensure that every sample is submerged.
      3. Seal S-block with a thermally stable adhesive plate cover; add extra security with lab tape so that the adhesive cover does not pop off during overnight digestion (samples will evaporate if this happens).
      4. Secure in a thermal shaker set to 56 °C; shake at 200 rpm overnight or up to 18 h.
         
         
         
2. Genomic DNA extraction
   1. QIAcube HT setup
      1. After overnight sample digest, open QIAcube HT’s QIAamp 96 protocol.
      2. Follow the setup wizard in the QIAamp 96 QIAcube HT protocol to input sample number and make the following customizations.
         1. Make elution volume 150 μl (Figure 6A).
            Note: In our hands, 150 μl elution produces sample yield between 10-50 ng/μl, which we found to be the best range for sample dilution. You may need to change elution volume to optimize yield range. 
         2. Remove Top Elute (change volume to 0) (Figure 6B).
            Note: With experimentation, we found that using Top Elute is messy and does not improve sample yield or quality.
      3. Set up deck according to the specifications on the software program.
      4. Deionize the deck with an ionizing gun or fan prior to running the protocol.
         
         
         Figure 6. QIAcube setup. A. Set Elution Buffer to 150 μl. B. Set Top Elute volume to 0 μl.
         
         
   2. Storage: once the protocol is finished, cover the elution plate with adhesive tape and lid, label, and store at 4 °C until ready to use.
      Note: The kit instructs the user to use the rubber tube caps, but we find that to be cumbersome and have an increased chance of liquid flicking into another well.
      
      
      
3. Genomic DNA Dilution
   1. Use a plate reader or MultiDrop to take 260 nm, 280 nm, and 320 nm readings of the DNA (if using a plate reader, dilute gDNA 1:10 in water in a UV plate).
   2. Quantify the concentration and 260/280 ratio; ensure that 260/280 values are approximately 1.8.
      Note: Another ratio that indicates sample purity is 260/230. Ideal 260/230 values are at least 1.0, but we have not found that 260/230 values have a significant effect on qPCR results so it is not further addressed in this protocol.
   3. Find the samples with the highest concentration; choose one dilution factor for the whole plate that ensures that the highest concentration sample does not exceed 1 ng/μl and the lowest concentration sample is not lower than 0.02 ng/μl.
   4. Dilute all samples in PCR-clean water in a new plate and mix well.
      
      
      
4. Standard curve setup
   1. Combine and mix several samples’ worth of high-quality genomic DNA made from several different SOD1^G93A mice to a total of approximate 100 μl of mixed sample.
   2. Find the concentration (ideally, use a NanoDrop for most accurate results); take a few replicates to make absolutely sure.
   3. Dilute the sample down to 2 ng/μl in 80 μl volume with PCR-clean water; save remaining mixed gDNA stock at -20 °C for future standard curves.
   4. Starting with 70 μl of 2 ng/μl gDNA, make 8 serial two-fold dilutions in PCR-clean water in one column of a PCR plate; this creates a standard curve where the most-concentrated sample is 2 ng/μl and the least is 0.016 ng/μl (Figure 7).
      Note: You can make more than one standard curve at a time if you use them a lot, and store them at 4 °C.
   5. Cover with adhesive plate sealer and store at 4 °C. Use aseptic technique every time you use the standard curve.
      
      
      Figure 7. Standard curve setup in a 96-well mixer plate
      
      
5. qPCR setup
   1. Primer setup
      1. Dilute dry primers according to the “Primer Dilution solution” (Recipe 3); leave on the bench for 10 min, vortex, and spin down.
      2. Aliquot into 100 μl aliquots, label, and store at -20 °C.
      3. Aliquot wet probes into 20 μl aliquots, label, and store at -20 °C.
   2. qPCR Master Mix
      1. Make master mix according to the “SOD1^G93A Copy Number Genotyping qPCR Master Mix solution” (Recipe 4), using appropriate excess (be sure to include standard curve in sample number calculations and make enough for two genes, SOD1 and Gapdh).
      2. Create SOD1 and Gapdh mixes according to the “Primer/Probe solution” (Recipe 5), using appropriate excess. Remember when calculating excess that you can use at most half of the number of excess samples that you used for the master mix for the SOD1 and Gapdh mixes. Mix gently; store at 4 °C covered with foil until ready to use (not more than 1-2 h).
      3. Label 2 96-well PCR plates “SOD1” and “Gapdh”, respectively.
      4. Aliquot 4 μl of diluted unknown gDNA into each plate.
      5. Add 4 μl of standard curve after the last column of samples on the Gapdh plate.
      6. Aliquot 20 μl of SOD1 master mix to each sample well of the SOD1 plate; pipette mix very well but do not introduce bubbles. Repeat with Gapdh plate and master mix.
      7. Spin plates at 180 x g for 3 min.
      8. Starting with the SOD1 plate, pipette 9.8 μl duplicates across a 384-well qPCR plate with an 8-channel pipette so that the samples occupy rows A, C, E, G, etc. Repeat with Gapdh directly under the SOD1 rows so that Gapdh samples occupy rows B, D, F, H, etc.; make sure to include standard curve (Figure 8).
         
         
         Figure 8. A few example columns of a qPCR plate map in a 384-well plate. Gapdh standard curve samples would be added to the final two columns in duplicate after all samples have been added.
         
         
      9. Spin at 400 x g for 3 min.
      10. Seal the plate with an optical plate sealer and run a standard-length TaqMan qPCR (Figure 9).
          
          
          Figure 9. Standard-length genotyping qPCR cycling conditions for qPCR machine setup

Data analysis

1. Organize data
   1. Export the following data from the qPCR machine into Microsoft Excel: Raw Ct, Sample Name, Target Name.
   2. Find the average raw Ct of each set of duplicates.
      
      
      
2. Find interpolated concentrations of unknowns using standard curve
   1. Open an XY spreadsheet in GraphPad Prism; choose “Enter X values” and “Enter and plot a single Y value for each point”.
   2. Label the X column “Concentration, ng/μl” and the first Y column “Gapdh Ct”.
   3. In the first 8 rows of the “Concentration”, put the concentration values of the standard curve (2, 1, 0.5, 0.25, 0.125, 0.0625, 0.03125, 0.015625).
   4. In the first 8 rows of the “Gapdh Ct” column, paste the raw average Ct values for your Gapdh standard curve.
   5. Click “Analyze” and choose “Nonlinear Regression” (If you need to choose again, choose semilog line–X is log, Y is linear”). Make sure “Interpolate unknowns from standard curve” is checked.
   6. Ensure that R-squared value is at least 0.99 in the Table of Results tab.
   7. Starting at Row 9, paste in raw average Gapdh Cts under “Gapdh Ct” column; a new Result tab will appear called “Interpolated X Values”.
      
      
      
3. Normalize SOD1 Cts using interpolated concentrations
   1. Create a table in Excel with the following headings: Sample, Target Ct, Gapdh Concentration, Normalization Value, Normalization Coefficient, Log, Normalized SOD1 Ct.
   2. Use Figure 10A to put appropriate values into each column.
      
      
      
4. Find relative copy number
   1. In a separate sheet, paste the Samples and their Normalized Target Ct values. Rank them from lowest to highest Ct using the Sort function, and assign them rank numbers starting at 1. If there are wild-types in your samples (Cts approaching 40), do not include them in this table. 
   2. Create a table in a separate Excel document with the following headings: Rank, Sample, Ct, Median, Ct-Median, Fold Change, Relative Copies.
   3. Use Figure 10B to put appropriate values into each column using your new ranked table.
      
      
      Figure 10. Excel table setup for Ct normalization and relative copy number calculation. A. Normalization of SOD1 Cts using interpolated Gapdh concentration. B. Relative copy number calculation.
      
      
      
5. Make genotype calls
   1. As shown in the Background section, we found that 16 “relative copies” and above causes mice to have a normal lifespan. We make the “low copy” call for mice with 15 relative copies and fewer.
      Note: While we found that 15 copies were a safe threshold, you can be as strenuous as you want. For larger and higher-powered efficacy studies it may be worth it to change the threshold to 18 or 20 to make absolutely sure that no lower copy mice are put into the study.
   2. If you are analyzing stud tails, be more conservative because this affects the future of your colony. We use 18 as the cutoff for stud tails.
   3. It is worth keeping track of stud males for each cohort; if there is a large number of low copies in a cohort, they may all be the progeny of one low copy male.
      
      
      
6. Representative Data
   Please see the attached Excel document “Representative Data Spreadsheet 08152018” for a representative set of data, including Excel formulas.
   

Notes

1. Although no genotyping protocol is described in this paper, the mice were genotyped using this SOD1^G93A genotyping protocol.
2. There are many ways to arrive at high-quality genomic DNA; this method is written about our specific method, which has been optimized and customized for minimal cross-contamination,
3. This protocol was written with this piece of equipment in mind; however, you can use another piece of equipment with comparable function.
   

Recipes

1. Sample Prep solution
   
   
   
2. Tissue Digestion solution
   
   
   
3. Primer Dilution solution
   
   
   
4. SOD1^G93A Copy Number Genotyping qPCR Master Mix
   
   
   
5. Primer/Probe solution
   
   

Acknowledgments

We acknowledge Matt Ferola and Carlos Maya for diligent and experienced mouse husbandry; we acknowledge Shawn Sullivan for his contribution to the acquisition of historical data. We thank Augie’s Quest for generous support of these studies. We thank people living with ALS for inspiring this research.

Competing interests

The authors declare no competing interests.

Ethics

All experiments were conducted in accordance with the protocols described by the National Institutes of Health Guide for the Care and Use of Animals and were approved by ALS TDI’s institutional animal care and use committee (IACUC). The IACUC ID is 2016-011 and the validity period is December 2016 through December 2019.

References

1. Alexander, G. M., Erwin, K. L., Byers, N., Deitch, J. S., Augelli, B. J., Blankenhorn, E. P. and Heiman-Patterson, T. D. (2004). Effect of transgene copy number on survival in the G93A SOD1 transgenic mouse model of ALS. Brain Res Mol Brain Res 130(1-2): 7-15.
2. Maier, M., Welt, T., Wirth, F., Montrasio, F., Preisig, D., McAfoose, J., Vieira, F. G., Kulic, L., Spani, C., Stehle, T., Perrin, S., Weber, M., Hock, C., Nitsch, R. M. and Grimm, J. (2018). A human-derived antibody targets misfolded SOD1 and ameliorates motor symptoms in mouse models of amyotrophic lateral sclerosis. Sci Transl Med 10(470). 
3. Morrice, J. R., Gregory-Evans, C. Y. and Shaw, C. A. (2018). Animal models of amyotrophic lateral sclerosis: A comparison of model validity. Neural Regen Res 13(12): 2050-2054.
4. Vieira, F. G., Hatzipetros, T., Thompson, K., Moreno, A. J., Kidd, J. D., Tassinari, V. R., Levine, B., Perrin, S. and Gill, A. (2017). CuATSM efficacy is independently replicated in a SOD1 mouse model of ALS while unmetallated ATSM therapy fails to reveal benefits. IBRO Rep 2: 47-53.
5. Zwiegers, P., Lee, G. and Shaw, C. A. (2014). Reduction in hSOD1 copy number significantly impacts ALS phenotype presentation in G37R (line 29) mice: implications for the assessment of putative therapeutic agents. J Negat Results Biomed 13: 14.