Lab protocol to quantify siRNA strands via stem loop qPCR

Declaimer: The protocol has been optimized to work with snap frozen or RNAlater preserved liver and kidney samples from unchallenged C57BL/6 mice. However, this protocol can be used as a starting point to expand to other tissues.

Material used:

• Lysis buffer (QuantiGene, QuantiGene™ Sample Processing Kit, tissues (Cat. No. QS0106, Lot: 378856-000)
• + Proteinase K (50µg/µl, from QuantiGene Kit above)
• Tissue Lyser (Retch Type MM300)
• Tungsten Carbide Beads (Qiagen Ref: 69997; Qiagen, Venlo, Netherlands))

• 2 ml PCR-clean centrifugation tubes (Sarstedt, Cat. 72695400)

   

Preparation of tissue lysates:

1. Weigh in organ sample of around ~30 mg (at least 20 mg)/tube, note down weight for lysis buffer volume adjustment, work at -80°C via precooling cutting plate and on dry ice if snap frozen tissues are used, otherwise at RT for RNAlater samples.

2. Prepare QuantiGene lysis buffer at RT: 1:100 dilution of lysis buffer with proteinase K.

   • E.g., 30690 μL homogenizing solution + 310 μL proteinase K.

3. Quickly pipette the appropriate volume of lysis buffer to the tissue at RT

   • 7.5 µL lysis buffer/1 mg tissue. (can be adjusted to 15µl/mg)

4. Add one Tungsten Carbide Bead/tube
5. Shred tissue 5x30s at 27.5Hz (after second C fourth time -> centrifuge tubes briefly) at RT
6. Ultimately, centrifuge tubes briefly.
7. Incubate lysate for 30 min at 65°C (vortex briefly every 10 min).
8. After 30 minutes centrifuge for 10 min at RT at 16,000 rpm (21,000 × g).
9. Split the supernatant: 1x 60 µL C 1x remaining volume (~120 µl) into a 96-well plate. Be sure to avoid pallet contamination for either sample.

10. Checkpoint: Either proceed immediately with the stem loop assay or store at -80 to -20°C.

     

Preparation of stem loop primer (SL) for reverse transcriptase:

Note: Primers were previously heated in previous experiments and can be stored at -20°C!

1. Dissolve SL Primer in Ultra-pure water and prepare 100µM stock solution
   • SL-Primer (AT3): GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTAACA

2. Re-/Fold primer by transferring 50 µl to a new tube and heat in a PCR thermocycler. Use the following heating steps:

    

   

    

3. Dilute heated SL Primer 100 µM (100,000 nM) to 250 nM =1:400
   • SL Primer [µl]                                10
   • Nuclease-free H2O [µl]          3990

   • Total volume [µl]                       4000

      

Prepare standard series for reverse transcriptase:

• It is recommended to use the same siRNA conjugate batch as administered in the animal experiment.
• Also, it is recommended that when generating data for different molecular designs, each siRNA conjugate has its own standard series and quality control (QC).
• Untreated animal samples or vehicle control animals (e.g., liver lysate from a PBS-treated animal) are used as a matrix for the standard and QC

  • Use water for molecular biology not DEPC treated water (e.g., TH. GEYER, Cat:7711-500ml)

     

Pipetting execution:

• Matrix is prepared from the current experiment of PBS animals
  • The dilution of the matrix in the standard curve depends on the samples we want to quantify
  • The standard and sample must be diluted to the same dilution level

1. Diluting animal samples:

   • Pipette each point 3 times to achieve “true triplicates!”

      

     

    

2. Then dilute the untreated or PBS lysate in ultra-pure water, which will be the matrix

    

   

    

3. Standard series siRNA conjugates: For all siRNAs:

   • Thaw 20 µM stock
   • Dilute 20 µM stock to 5 µM (12.5 µl 20 µM + 37.5 µl ultra-pure H2O)
   • Dilute 5 µM stock to 0,5 µM (10.0 µl 20 µM + 90.0 µl ultra-pure H2O)

   →siRNA Stock (Stock 500 nM)

   Everything is pipetted with a single channel pipette (2µl-20µl C 10µl-100µl)

    

   B) Pre-dilute siRNA conjugate (heated stock) for the standard series, which equals 10x concentration of the starting concentration of the standard row.

    

   

    

   Pipette standard series for each siRNA, lysate 1:400 (serial dilution):

   →Pipette each point 3 times to achieve “true triplicates!”

    

   

    

4. Quality controls for each siRNA pipette, lysate 1:400 (serial dilution):

    

   Pipette each point 3 times to achieve “true triplicates!”

    

   → everything else is pipetted using the Sartorius Picus electronic pipette. (5µl-120µl C 10µl-300µl)

    

5. Pipette 4 µl of pre-diluted sample (2.), standard (3.), or QC (4.) into a LoBind PCR plate (Eppendorf twin.tec®-PCR-Platte 96 LoBind, skirted, 150 µL, PCR clean, colorless (Eppendorf AG, Cat: 0030129512)

• Melt the duplexes by heating the plate in a PCR cycler for 10 min at 95°C,

• Then place immediately on ice (Reason: This will avoid rehybridization of the single strands)

• Then centrifuge briefly to collect condensation.

   

Reverse transcriptase reaction:

Example plate layout:

Example master mix preparation for 96 samples:

→Pipette 6 µl RT master mix into the pre-diluted C heated samples or standards and centrifuge briefly

→Final Volumes: 4 µL template (siRNA/A strand) + 6 µL revTrans Master mix

Checkpoint opportunity:  Pipette immediately into a qPCR with the transcript or freeze at -20 °C! Overnight storage in the thermocycler at 4°C is also acceptable!
 

qPCR reaction:

Example plate layout:

1. Dilute sample:
   • Transfer 20 µl nuclease-free water to new 384-well plate and add 5 µL of RT-product reverse-transcribed sample.
   • Mix by pipetting up and down
   • Transfer 5 μL of this diluted sample into PCR reaction plate. Add 15 µl of the PCR master mix per 20-μL PCR reaction into the wells
2. Solve Upper, Lower C Probe Primer in ultra-pure water and vortex
   • Store at -20°C)

3. Prepare Master Mix for qPCR:

    

   

    

4. Pipette 5 µL diluted revTransc. and 15 µL qPCR MasterMix into a MicroAmp Fast 384- well reaction plate

   

Calculations of standard and QC:

To calculate the concentration of the unknown samples, use a 5-parameter non-linear fit. We used an Asymmetric Sigmoidal, 5PL where X is log(concentration). Calculations are done in GraphPad Prism.