Materials and Reagents

Qiagen Type-it Microsatellite PCR kit (QIAGEN, catalog number: 206243 )
1x TE buffer (10 mM Tris, bring to pH 8.0 with HCl, 1 mM EDTA)
GelRed (Biotium, catalog number: 41003 )
1 kb DNA ladder (GeneRuler 1 kb DNA Ladder) (Thermo Fisher Scientific, catalog number: SM0313 )
Nuclease-free water
Pure molecular biology grade ethanol (96–100%)
2 ml tubes
DNeasy 96 Plant Kit (QIAGEN, catalog number: 69181 )
Hi-Di™ formamide (Life Technologies, catalog number: 4311320 )
GeneScan 500 LIZ size standard (Life Technologies, catalog number: 4322682 )
Ice
Glucose (BD Biosciences, catalog number: 215510 )
Proteose pepton (BD Biosciences, catalog number: 212230 )
Agar (BD Biosciences, catalog number: 214883 )
2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES) (Life Technologies, Gibco^®, catalog number: 11330032 )
Laboratory wipes (e.g., KimWipes, Kimberly-Clark, catalog number: TW31KWPBX )
4 mm steel balls (e.g., Spex Certiprep, catalog number: 12145950 )
Pipette tips
Pipette (0.1-2 μl), pipette tips
Processing plate: 96-well plate (e.g., MicroAmp Optical 96-Well Reaction Plate) and 96-well plate (Septa)
0.22 µm sterile polyethersulfon syringe filter (Merck Millipore, catalog number: P/N SLMP025SS )
Algal medium (see Recipes)
Algal culture medium preparation for growing Dictyochloropsis and other trebouxiophycean algal strains (see Recipes)
Vitamin solution (see Recipes)

Equipment

Multi-channel pipettes (0.1-10, 10-100, 100-1000 μl), with extended tips
Microcentrifuge with rotor for 2 ml tubes
Centrifuge for 96-well plates
BioRad Gel casting tray, running tray, power pack etc. (Bio-Rad Laboratories, catalog number: 164-0305 )
Incubator (65 °C)
Freezer or cold room at -20 °C
PCR Thermal cycler
ABI3130/ 3130xl/3730/3730xl DNA Analyzer (Applied Biosystems)
Ball Mill MM 400 (Retsch^®, catalog number: 20.745.0001 )
Lyophilizer (e.g., FreeZone 4.5 Liter Benchtop Freeze Dry System, Labconco, catalog number: 7750021 )

Software

GeneMapper^® (Software v4.1, Applied Biosystems, catalog number: 4366925)

Procedure

Sample preparation (Day 1)
1. Take up to 10 mg fresh tissue sample (approximate wet weight) or 5 mm diameter in size of algal culture (Beck et al., 1998) / lichen thallus in 2 ml tube (see Figure 2).
2. Add 2 steel balls in each tube.
3. Cover the open tubes with soft tissue paper.
4. Cool samples in -20 °C freezer for at least 6 h.
5. Fit the tubes in the lyophilizer and lyophilize overnight.
  
  Figure 2. Example of samples used for DNA extraction
Sample grinding and DNA isolation (Day 2)
1. Close the tubes.
2. Crash the lyophilized samples using the ball mill MM 400 at 30 Hz for 30 sec without buffer at ambient temperature.
3. Spin down for a few seconds the crashed sample before proceeding with DNA isolation.
4. For DNA isolation follow DNeasy 96 Plant Kit, Qiagen protocol (Plant Handbook 10/2012, http://www.qiagen.com, pages 31-34).
  Notes:
  1. For buffers AW1 and AW2, before using for the first time, add the appropriate amount of ethanol as indicated on the bottle to obtain a working solution.
  2. Preheat Buffer AP1 to 65 °C.
5. Elute the purified DNA from the DNeasy spin column using Buffer AE twice (2 x 50 μl).
  Note: Smaller or larger elution volumes can be used for more or less concentrated products. To ensure complete elution, 40 μl should be the minimum elution volume.
DNA check
1. Prepare 1% agarose gel with 1x TAE buffer. Add 0.5 μl GelRed for 100 ml gel.
2. Load 2 μl DNA.
3. Add 1 kb or 100 bp ladder for reference.
4. Run the gel electrophoresis.
5. Check DNA for quality and quantity in gel doc system (Figure 3).
Figure 3. Example of good quality genomic DNA of Dictyochloropsis reticulata run on a 1% w/v agarose gel

PCR reactions and preparation of the genotyping plate (Day 3)
7x Primer mix

First prepare 100 μM primer stocks.
Mix all primers according to Tables 1 and 2 to get 1ml primer-mix (sufficient for 10x 96-sample PCR plate).

Table 1. Primer sequences and labeling of the microsatellite Multiplex 1 specific to Dictyochloropsis reticulata (Dal Grande et al., 2009; Dal Grande et al., 2014)

Algal Loci	Locus GenBank	Primer Sequence (5'-3')	Label

LPh1	FJ754261	F: GTCTCAGGTGACCACTTGATTG	VIC
		R: GCAATGGATATGATGCTTGTTC
LPh2	FJ754262	F: GACAGCTGTTCCAGTGCATC
		R: GCAGAGGAAGTGCATGACG	FAM
LPh3	FJ754263	F: TGCAGTAGGTGTCATATGTGT	NED
		R: GAAGGCGCATCTTGATATAC
LPh4	FJ754264	F: GTGGTGGTACAACATGCTCA	NED
		R: ACGACCACGTGGGATATCTA
LPh5	FJ754265	F: TGGTGTTAGTAAGAATCGGCATC	PET
		R: GTGTATGTCGGCCCCAATAA
LPh6	FJ754266	F: GAATCCTGCCTGCCTACAAG	FAM
		R: AGCAACCCATTTCAACCAAC
LPh7	FJ754267	F: TGTGACAGGTGAAACACCAA	VIC
		R: TATGGTCCCTCATGGCAAAT

Table 2. 7x primer mix preparation

Concentration of normalized primer stocks: 100 μM (100 pmol/μl)

Each primer 20 μl (30 μl for LPh7)
TE buffer 700 μl

Total volume 1 ml

PCR reaction mix

Thaw template DNA, RNase-free water, the primer mix and the 2x Type-it Microsatellite PCR Master Mix, if stored at -20 °C.
Mix the solutions completely before use.
Prepare a reaction mix according to Table 3.
Note: The reaction mix contains all the components required for multiplex PCR except the template DNA. Prepare a volume of reaction mix 10% greater than that required volume for the total number of reactions to be performed.
Mix the reaction mix thoroughly and dispense appropriate volumes into PCR tubes or plates.
Note: Mix gently by pipetting the reaction mix up and down a few times. It is not necessary to keep samples on ice during reaction setup.

Table 3. PCR components of the microsatellite multiplex (total volume = 10 μl)

PCR component	Multiplex 1 (10 μl)
Multiplex PCR Master Mix^a	5 μl (1x)
Primer mix	1 μl (0.2 μM of each primer, 0.3 μM for LPh7)
DNA template	1 μl (1–10 ng)
RNase-free water	3 μl

PCR program
1. Step 1: 95 °C for 5 min (initial activation)
2. Step 2: 95 °C for 30 sec (denaturation)
3. Step 3: 62 °C for 90 sec (annealing)
4. Step 4: 72 °C for 60 sec (extension)
5. Step 5: go to step F2, repeat 24 times
6. Step 6: 60 °C for 30 min (final extension)
7. Store PCR products in -20 °C, until further processing.
Preparation of the plate for genotyping (Day 4)
1. Dilute the PCR products 1: 10 with RNAse-free water.
2. Combine 1 μl of diluted PCR product with a buffer containing 9 μl of a denaturing agent (Hi-Di™ Formamide) and 0.5 μl LIZ500 size standard.
3. Note: For one 96 well plate prepare buffer for 105 samples.
4. Centrifuge the plates briefly (5 sec) at 1,500 RCF.
5. Prepare table of samples.
  Note: Fill any blank sample-well with nuclease-free water.
6. Analyze on an ABI3730xl.
Analysis (Day 5)
Import the raw data files generated by the sequencer to the computer with GeneMapper software.
Genotyping in GeneMapper
1. Select ‘Create new project’ from the 'File' menu.
2. Import your samples.
3. Create marker panel and bin set.
  Analysis parameters
4. Choose ‘Microsatellite default’ as table setting and ‘Microsatellite analysis method’ as the analysis method.
5. Set the panel for the 7x-primer mix.
6. Set size standard as LIZ500 and exclude the 35- and 250-bp peaks.
7. Analyze (see Figure 4).
  Note: If some samples fail to match size standards, go to edit size standards and override size. If this does not solve the issue, there might be some problem with the sample or the analysis run.
Figure 4. Example of the 7x-multiplex microsatellite electropherogram for one sample of Dictyochloropsis reticulata

Representative data

A simple, representative example of data that indicates what type of results to expect (Table 4).

Table 4. Example of a 7x-multiplex microsatellite allele table

Sample	Population	LPh1	LPh2	LPh3	LPh4	LPh5	LPh6	LPh7
1	Pop1	262	157	108	191	143	121	170
2	Pop2	260	151	138	176	156	121	190
3	PopN	148	159	122	181	140	116	152

Note: Numbers indicate the relative size of each microsatellite allele in base pairs.

Recipes

Algal medium
Ingredients for the preparation of algal culture medium
1. Macronutrients (g/400 ml)
  NaCl                     1                (42.7 mM)
  CaCl₂^.2H₂O        1                (17.0 mM)
  KNO₃                 20              (495 mM)
  MgSO₄^.7H₂O       3                (30.4 mM)
  (NH₄)₂.HPO₄       10                (189 mM)
2. Micronutrients (g/500 ml)
  KOH                    15           (535 mM)
  EDTA:                    25           (171 mM)
  FeSO₄^.7H₂O       2.49        (17.9 mM)
  H₃BO₃                  5.52         (179 mM)
  ZnSO₄^.7H₂O         4.41        (30.7 mM)
  MnCl₂^.4H₂O          0.72          (7.28 mM)
  NaMoO₄                0.36    (3.50 mM)
  CuSO₄^.5H₂O       0.79    (6.33 mM)
  Co(NO₃)₂^.6H₂O      0.25   (1.72 mM)
Algal culture medium preparation for growing Dictyochloropsis and other trebouxiophycean algal strains
1. For one liter of medium, take 10 ml of macronutrients and 1 ml of micronutrients, add 0.715 g HEPES buffer (final concentration 3 mM) and fill up to 1,000 ml with distilled water.
2. Adjust pH to 5.5 with HCl.
3. 20 g agar may be added.
4. Autoclave and add 1 ml sterile vitamin solution after cooling down to at least 60 °C. Sterilize the vitamin solution by filtration using a 0.22 µm sterile polyethersulfon syringe filter.
  Note: To receive higher amounts of algal cells 1.5% glucose and 1% proteose pepton can be added.
Vitamin solution
Thiamine       0.1 g/100 ml      (3.77 mM)
Biotin        2.5 mg/100 ml        (0.10 mM)
Vitamin B12       1.5 mg/100 ml       (9.50 µM)

Acknowledgments

This study was supported by ‘LOEWE, Landes-Offensive zur Entwicklung Wissenschaftlich-oekonomischer Exzellenz’ of Hesse’s Ministry of Higher Education, Research, and the Arts, by the Swiss National Science Foundation (projects 31003A-105830 and 31003A-127346 to C.S.), and by the German National Science Foundation (project BE3825/4-1 to A.B.).

References

Beck, A., Friedl, T. and Rambold, G. (1998). Selectivity of photobiont choice in a defined lichen community: inferences from cultural and molecular studies. New Phytologist 139(4): 709-720.
Dal Grande, F., Beck, A., Cornejo, C., Singh, G., Cheenacharoen, S., Nelsen, M. P. and Scheidegger, C. (2014). Molecular phylogeny and symbiotic selectivity of the green algal genus Dictyochloropsis s.l. (Trebouxiophyceae): a polyphyletic and widespread group forming photobiont-mediated guilds in the lichen family Lobariaceae. New Phytol 202(2): 455-470.
Dal Grande, F., Widmer, I., Beck, A. and Scheidegger, C. (2010). Microsatellite markers for Dictyochloropsis reticulata (Trebouxiophyceae), the symbiotic alga of the lichen Lobaria pulmonaria (L.). Conservation Genetics 11(3): 1147-1149.