-
5-ml serological pipettes (Fisherbrand, catalog number: 13-678-11D)
-
10-ml serological pipettes (Fisherbrand, catalog number: 13-678-11E)
-
25-ml serological pipettes (Fisherbrand, catalog number: 13-678-11)
-
Filtered 10 μl micropipette tips (MultiMax, catalog number: JM2015-108)
-
Filtered 200 μl micropipette tips (MultiMax, catalog number: B-2104-SH)
-
Filtered 1,250 μl micropipette tips (MultiMax, catalog number: B-2105-L)
-
15-ml conical centrifuge tubes (TrueLine, catalog number: TR2000)
-
50-ml conical centrifuge tubes (TrueLine, catalog number: TR2003)
-
1.5-ml Optimum Microcentrifuge tubes (Life Science Products, catalog number: 8215-0500N)
-
96-well PCR plates (Fisherbrand, catalog number: 14230232)
-
Sterile 2 mil Seal Film Tape for PCR (Life Science Products, catalog number: ST-3099)
-
Foil PCR plate seals (Fisher Scientific, Axygen, catalog number: 14-222-343)
-
96-well cell culture plates (Falcon, catalog number: 353077)
-
12-well cell culture plates (Falcon, catalog number: 353043)
-
6-well cell culture plates (Falcon, catalog number: 353046)
-
10-cm tissue culture dishes (Falcon, catalog number: 353003)
-
T25 tissue culture flasks (Thermo Scientific Nunc, catalog number: 156367)
-
T75 tissue culture flasks (Thermo Scientific Nunc, catalog number: 156499)
-
5-ml disposable syringes (BD, catalog number: 1482945)
-
Millex HV syringe filter, 0.45 μm (EMD Millipore, catalog number: SLHV033RS)
-
Syringe filters, 0.2 μm (Corning, catalog number: 431219)
-
Wide-bore filter tips (ART, catalog number: 212362C)
-
1.8-ml cryotubes (Thermo Fisher Nunc, catalog number: 377267)
-
Sterile 14-ml round-bottom tubes (Falcon, catalog number: 352059)
-
Caplugs sterile polypropylene culture tubes, 4 ml (Evergreen Scientific, catalog number: 05-551-2)
-
Rapid-Flow Sterile Disposable Filter Units, 500 ml, 0.2 μm (Nalgene, catalog number: 569-0020)
-
Blunt cannulas, 15-gauge (Covidien Monoject, catalog number: 22-652-085)
-
100 μm cell strainer (Falcon, catalog number: 352360)
-
10 cm Petri dishes (Fisherbrand, catalog number: 08-757-12)
-
Synthetic double-stranded DNA fragments (TWIST Bioscience or Integrated DNA Technologies, custom)
-
Cell lines
-
5KC α-β- (Nakayama Lab, available upon request with MTA)
-
Phoenix-ECO (ATCC, catalog number: CRL-3214)
-
K562 (ATCC, catalog number: CCL-243)
-
293FT (Fisher, catalog number: R70007)
-
Vectors
-
8xNFAT-ZsG-hCD8 (Addgene, catalog number: 153417)
-
Murine CD3 WTdelta-F2A-gamma-T2A-epsilon-P2A-zeta pMIA II [CD3-AM] (Addgene catalog number: 52093)
-
CD3-2A_pMI-LO [CD3-LO] (Addgene, catalog number: 153418)
-
pMSCVII (Addgene, catalog number: 162750)
-
pMSCVII-AM [pMSCV-AM] (Addgene, catalog number: 162751)
-
pMSCVII-LO [pMSCV-LO] (Addgene, catalog number: 162754)
-
pMSCVII-BFP [pMSCV-BFP] (Addgene, catalog number: 162755)
-
pMSCVII-tdTomato [pMSCV-TM] (Addgene, catalog number: 162752)
-
pMSCVII-E2Crimson [pMSCV-CR] (Addgene, catalog number: 162756)
-
pMSCVII-mChe [pMSCV-mChe] (Addgene, catalog number: 162753)
-
MBC1-null (Addgene, catalog number: 162748)
-
MBC2-null (Addgene, catalog number: 162749)
-
CaP2AIII_pK18 [CaP2AIII] (Addgene, catalog number: 153421)
-
pUS (Addgene, catalog number: 153416)
-
A2_uSFFV (Addgene, catalog number: 153415)
-
pCL-ECO (Addgene, catalog number: 12371)
-
pMD2.G (Addgene, catalog number: 12259)
-
psPAX2 (Addgene, catalog number: 12260)
-
Restriction enzymes (New England Biolabs)
-
BspEI (NEB, catalog number: R0540S)
-
HindIII (NEB, catalog number: R0104S)
-
MfeI (NEB, catalog number: R0589S)
-
HpaI (NEB, catalog number: R0105S)
-
EcoRI (NEB, catalog number: R0101S)
-
XhoI (NEB, catalog number: R0146S)
-
MscI (NEB, catalog number: R0534S)
-
AleI-v2 (NEB, catalog number: R0685S)
-
SalI (NEB, catalog number: R0138S)
-
BglII (NEB, catalog number: R0144S)
-
MluI-HF (NEB, catalog number: R3198S)
-
SbfI (NEB, catalog number: R0642S)
-
Primers (Integrated DNA Technologies)
-
BspEI-F (GCGGGCGCCCGAAGGTCCT)
-
Hind Seq-R (GGCTTCAGCTGGTGAAGCTT)
-
CD3-Seq (ATGGCCTTTACCAGGGTCTC)
-
SalI-Seq (GCATGCTAGCTATAGTTCTAGAG)
-
5pMIG (GCCTCCTCTTCCTCCATCCG)
-
3LTR-2 (AATTTGCGCATGCTAGCTATAG)
-
TRAC1-R (CAGGCAGAGGGTGCTGTCCTG)
-
5MAC3 (AGAGACCAACGCCACCTACC)
-
3TRBC (CAAGGAGACCTTGGGTGGAG)
-
Cas9-S14 (CACATAGCGTAAAAGGAGC)
-
Cas9-S16 (AAGAGCTCACAACCCCTCAC)
-
P2A-R (GAAGTTCGTGGCTCCGGAG)
-
PGK-F2 (CATTCCACATCCACCGGTAG)
-
P2A-F (CTCCGGAGCCACGAACTTC)
-
P2A-R2 (GGGACCGGGGTTTTCTTCCAC)
-
3LTR (GCAAAATGGCGTTACTTAAGC)
-
IRES-Seq (CTGATCTGGGGCCTCGGTGC)
-
LB broth (Gibco, catalog number: 10855-021)
-
LB agar (BD Difco, catalog number: 244520)
-
Ampicillin Ready Made Solution (Sigma-Aldrich, catalog number: A5354-10ML)
-
QIAQuick Gel Extraction Kit (Qiagen, catalog number: 28704)
-
QIAQuick PCR Clean-up Kit (Qiagen, catalog number: 28104)
-
Qiagen Minelute Gel Extraction Kit (Qiagen, catalog number: 28604)
-
NEBuilder HiFi DNA Assembly Master Mix (NEB, catalog number: E2621L)
-
NEB 5-alpha Competent E. coli (HE) (NEB, catalog number: C2987H)
-
Agarose (Fisherbrand, catalog number: BP160-500)
-
Ethidium bromide, 10 mg/ml (Fisher Scientific, Invitrogen, catalog number: 15-585-011)
-
PreMix D (Lucigen, catalog number: MO7205D)
-
Taq DNA Polymerase (Sigma, catalog number: D1806-20X250UN)
-
100 bp DNA ladder (Fisher Scientific, Invitrogen, catalog number: 15628-019)
-
1 Kb Plus DNA ladder (Fisher Scientific, Invitrogen, catalog number: 10-787-018)
-
Qiagen Plasmid Plus Midi Kit (Qiagen, catalog number: 12943)
-
Fetal bovine serum (FBS) (Atlanta Biologicals, catalog number: S11150H)
-
Lipofectamine 2000 (Invitrogen, catalog number: 11668-500)
-
Molecular biology grade water (HyClone, catalog number: 3053801)
-
Poly-D-lysine (PDL) hydrobromide lyophilized powder (Sigma-Aldrich, catalog number: P6407-10x5MG)
-
Sterile cell culture grade water (HyClone Water, Cell Culture Grade (Endotoxin-Free), catalog number: SH3052901)
-
Phosphate-buffered saline (PBS), pH 7.4 (Gibco, catalog number: 10010023)
-
Penicillin/streptomycin (pen/strep), sterile filtered (Sigma-Aldrich, catalog number: P0781)
-
Trypsin-EDTA, 0.25% (Gibco, catalog number: 25200-056)
-
Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, catalog number: 11965-092)
-
Iscove’s Modified Dulbecco’s Medium (IMDM) (Gibco, catalog number: 12440079)
-
RPMI 1640 medium, no phenol red (Gibco, catalog number: 11835030)
-
MEM Non-essential Amino Acids Solution (MEM-NEAA) (100x) (Gibco, catalog number: 11140-050)
-
HEPES Buffer, 1 M (Gibco, catalog number: 15630-080)
-
Sodium Pyruvate, 100 mM (Gibco, catalog number: 11360-070)
-
2-mercaptoethanol [14.3 M] (Sigma-Aldrich, catalog number: M3148)
-
Dimethyl sulfoxide (DMSO) (Fisher Bioreagents, catalog number: BP231-100)
-
Protamine sulfate powder (MP Biomedicals, catalog number: ICN19472901)
-
PE-labeled anti-human CD8 antibody (Biolegend, clone SK1, catalog number: 344706)
-
Anti-mouse CD3e antibody, functional grade (BD, clone 145-2C11, catalog number: 553057)
-
PE-labeled anti-mouse CD3e antibody (BD, clone 145-2C11, catalog number: 553064)
-
PE-labeled anti-HLA-ABC antibody (BD, clone G46-2.6, catalog number: 560964)
-
Mouse CD3e microbead kit (Miltenyi Biotec, catalog number: 130-094-973)
-
Zombie NIR Fixable Viability Kit (BioLegend, catalog number 423105)
-
Transfection medium (see Recipes)
-
5KC medium (see Recipes)
-
Phoenix medium (see Recipes)
-
5KC Freezing Medium (see Recipes)
-
Phenol red-free RPMI (see Recipes)
-
Protamine sulfate, 5 mg/ml solution (see Recipes)
-
PDL, 0.1 mg/ml (see Recipes)
-
LB-ampicillin Broth (see Recipes)
-
LB-ampicillin plates (see Recipes)
-
Pipet controller (Fisherbrand, catalog number: FB14955202)
-
Micropipettes (Fisherbrand Elite Kit, catalog number: 14-388-100)
-
Multichannel pipettors (Fisherbrand Elite series)
-
Water bath (Fisher Scientific, Corning, 6-L digital waterbath, catalog number: 07-202-156)
-
Ultra-low freezer (Thermo Scientific, TSX series, catalog number: TSX50086A)
-
Dry bath (Fisherbrand, Isotemp digital heat double-stranded DNA fragment, catalog number: 88-860-021)
-
Electrophoresis gel boxes (Fisher Scientific, Owl D4 Horizontal Electrophoresis System, catalog number: 09-528-205)
-
Electrophoresis power supply (Fisherbrand, catalog number: FB200Q)
-
PCR Thermal Cycler (Thermo Fisher Scientific, Applied Biosystems ProFlex 96-well PCR System, catalog number: 4484075)
-
NanoDrop 2000 spectrophotometer (Thermo Scientific, model: NanoDropTM 2000)
-
Shaking incubator (New Brunswick Scientific, model: Innova 43)
-
GelDoc Go Gel Imaging System (Bio-Rad, catalog number: 12009077)
-
Microcentrifuge (Fisherbrand accuSpinTM Micro 17, catalog number: 13-100-675)
-
Countess II automated cell counter (Invitrogen, catalog number: AMQAX1000)
-
Countess II slides (Invitrogen, catalog number: C10228)
-
Inverted light microscope (Olympus, model: IX53)
-
Bench centrifuge (Thermo Scientific, SorvallTM LegendTM XT/XF Centrifuge and Rotor Packages, catalog number: 75-333-839)
-
Biosafety BSL2 cabinet (NuAire, model: NU-425-400)
-
CO2 Incubator (Fisherbrand Isotemp CO2 Incubators, catalog number: 11-676-600)
-
Cytoflex (Beckman Coulter, https://www.beckman.com/flow-cytometry/instruments/cytoflex)
-
Mr. Frosty freezing container (Thermo Scientific, catalog number: 15-350-50)
-
MS Columns (Miltenyi Biotec, catalog number: 130-042-201)
-
OctoMACS Separator (Miltenyi Biotec, catalog number: 130-042-109)
-
MilliQ water machine (Millipore-Sigma, lot number: F8BA18025)
The workflow for this protocol is illustrated in Figure 2. In the first step, TCR expression cell lines are generated using vectors made as described in Steps A1 to A4. Transfection and transduction are used to introduce the vectors (Figure 1) into 5KC α-β- hybridoma T-cells to generate TCR expression cell lines having all components of the reporter system (along with eight distinct fluorescent identifiers) except TCR α and β chains (Steps B1 to B2c). These TCR expression cell lines can be expanded and frozen, and then used repeatedly for multiple rounds of TCR reporter cell line generation. In the second step, vectors with TCR α and β chains are generated (Step A5) and transduced into the TCR expression cell lines, resulting in functional reporter T-cells (Step B2d). In step 3, APC cell lines are generated expressing MHC genes of biological relevance, depending on the origin of TCRs being analyzed. Step A6 describes the generation of MHC expression vectors, and vectors are then transduced into APC cell lines (Step B3). In step 4, the multiplex stimulation assay is conducted by combining 8 different FP-identified T-cell reporter lines and co-culturing with APCs and antigens (Steps C1-C4). Finally, flow cytometry is used to measure positively stimulated cells by induction of the reporter color ZsGreen-1 (Step C5).