Materials and Reagents

HepG2 cells (ATCC, catalog number: HB 8065 )
DMSO (cell culture grade) (Sigma-Aldrich, catalog number: D2650 )
Phosphor-buffered saline (PBS) (Life Sciences, catalog number: 10010049 )
QIAamp DNA mini kit (QIAGEN, catalog number: 51304 )
TaqMan universal mastermix (Life Technologies, Applied Biosystems^®, catalog number: 4352042 )
β-actin Assay-on-Demand kit (Life Technologies, Applied Biosystems^®, catalog number: 4331182 )
Eagle’s minimum essential medium (Life Technologies, Gibco^®, catalog number: 41090 )
GlutaMAX^TM
Fetal bovine serum (FBS) (HyClone, catalog number: SH30071.03 )
100 units/ml penicillin, 100 units/ml streptomycin (Life Technologies, Gibco^®, catalog number: 15140 )
Sodium pyruvate (Life Technologies, Gibco^®, catalog number: 11360 )
Cells were cultured in Eagle’s minimum essential medium (see Recipes)
Note: Cells were cultured in Eagle’s minimum essential medium.

Equipment

12-well plates (Corning, catalog number: 3513 )
ABI Prism 7900HT Fast Real-Time PCR system (Life Technologies, Applied Biosystems^®)

Procedure

HepG2 cells were seeded into 12-well plates at a density of 2 x 10⁵ cells per well and allowed to attach overnight. The volume of medium was 1.0 ml in each well.
After the overnight incubation, the media in each well was replaced with 1.0 ml of fresh media containing tested compounds and controls, and incubated for 10 more days. The media was replaced with fresh media and compounds every 3 to 4 days. The DMSO concentration was kept at 1.0% for all treatments including control samples (no drug, DMSO only).
Following the incubation, the cells were washed once with PBS and the total DNA was extracted from the cells using the QIAamp DNA Mini Kit according to the manufacturer’s protocol.
Real-time PCR reactions were performed using TaqMan universal mastermix in an ABI Prism 7900HT Fast Real-Time PCR System.
Quantification of mtDNA was achieved by amplification of a fragment of the mitochondrial specific cytochrome b gene using the primers and probe described in Table 1. Chromosomal DNA was quantified by the amplification of a fragment of the β-actin gene using a β-actin Assay-on-Demand kit.

Amplification reactions for the quantification of mitochondrial and chromosomal DNA were performed independently using approximately 25 ng of total DNA in a volume of 20 μl.

Table 1. Real-Time PCR primers and probe used in the quantification of the cytochrome b gene from HepG2 cells

Primer/probe name	Oligonucleotide sequence	Concentration in qPCR
Cytochrome b forward	CCTTCCACCCTTACTACACAATCAA	0.9 μM
Cytochrome b reverse	GGTCTGGTGAGAATAGTGTTAATGTCA	0.9 μM
Cytochrome b probe	FAM-ACGCCCTCGGCTTAC-BHQ1	0.2 μM

Data analysis

The relative amount of mtDNA in treated samples was determined using a relative quantification method based upon the 2^-ΔΔC_T formula (Livak and Schmittgen, 2001).
The amount of mtDNA (% mtDNA) in compound treated samples relative to the DMSO treated controls was calculated based upon the following formula:
% mtDNA = 100 x 2^-ΔΔC_T
ΔΔC_T = ΔC_{T, treated} – ΔC_{T, control}
ΔC_{T, treated} = (C_T, cyt b – C_T, β-actin) _treated
ΔC_{T, control} = (C_T, cyt b – C_T, β-actin) _control
C_T, cyt b and C_T, β-actin represent the cycle threshold values for the amplification of cytochrome b and β-actin, respectively, as determined by the computational analysis of amplification curves using the ABI Prism software. The final results are presented as the mean % mtDNA ± SD from 3 independent experiments, each performed in triplicate.
The 2^-ΔΔC_T method was validated for cytochrome b and β-actin genes by determining the ΔC_T values for amplification reactions containing various amounts of total cellular DNA. Minimal differences were observed in the ΔC_T values in samples containing 5 to 40 ng of total cellular DNA; indicating that neither the amplification nor detection efficiencies of cytochrome b and β-actin were affected by the amount of DNA template within the dilution range relevant for the quantitative analysis performed in this study Table 2.

The effect of a positive control compound ddC (dideoxy cytidine) is shown in Table 3.

Table 2. Validation of the 2^-ΔΔC_T method for cytochome b and β-actin target genes

Amount of total cellular DNA (ng/reaction)	C_T Value^a		ΔC_T Value
Amount of total cellular DNA (ng/reaction)	Cytochome b	β-actin	ΔC_T Value
5	15.7 ± 0.4	22.2 ± 0.3	-6.6 ± 0.1
10	17.3 ± 0.4	23.9 ± 0.3	-6.7 ± 0.1
20	18.8 ± 0.3	25.7 ± 0.3	-6.9 ± 0.1
40	20.3 ± 0.4	27.3 ± 0.3	-7.0 ± 0.1

^aThe data represent the mean ± SD of 3 independent experiments performed in triplicate

Table 3. Effect of positive control ddC on the levels of mtDNA in HepG2 cells

Compound	Concentration (μM)	Relative amount of mtDNA (% mtDNA)^a	p-value compared to DMSO (control)^b
DMSO (control)	-	100.0 ± 8.8	-
ddC	0.2	57.0 ± 10.4	< 0.0001
	2.0	25.1 ± 7.8	< 0.0001
	20	6.9 ± 2.9	< 0.0001

^aThe data represent the mean ± SD of 3 independent experiments performed in triplicate
^bPaired, two-tailed Student’s t-test

Recipes

Eagle’s minimum essential medium
GlutaMAX^TM
10% fetal bovine serum
100 units/ml penicillin
100 units/ml streptomycin
1 mM sodium pyruvate

Acknowledgments

All of the work was sponsored by Gilead Sciences, Inc. This protocol was adapted from Feng et al. (2014).

References

Feng, J. Y., Cheng, G., Perry, J., Barauskas, O., Xu, Y., Fenaux, M., Eng, S., Tirunagari, N., Peng, B., Yu, M., Tian, Y., Lee, Y. J., Stepan, G., Lagpacan, L. L., Jin, D., Hung, M., Ku, K. S., Han, B., Kitrinos, K., Perron, M., Birkus, G., Wong, K. A., Zhong, W., Kim, C. U., Carey, A., Cho, A. and Ray, A. S. (2014). Inhibition of hepatitis C virus replication by GS-6620, a potent C-nucleoside monophosphate prodrug. Antimicrob Agents Chemother 58(4): 1930-1942.
Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4): 402-408.